UXT (NM_153477) Human Untagged Clone

CAT#: SC306615

UXT (untagged)-Human ubiquitously-expressed transcript (UXT), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UXT
• Synonyms: ART-27; STAP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153477, the custom clone sequence may differ by one or more nucleotides
  ATGGTCTTCCCCCTCCCCACTCCCCAGGAGCCCATCATGGCGACGCCCCCTAAGCGGCGG
  GCGGTGGAGGCCACGGGGGAGAAAGTGCTGCGCTACGAGACCTTCATCAGTGACGTGCTG
  CAGCGGGACTTGCGAAAGGTGCTGGACCATCGAGACAAGGTATATGAGCAGCTGGCCAAA
  TACCTTCAACTGAGAAATGTCATTGAGCGACTCCAGGAAGCTAAGCACTCGGAGTTATAT
  ATGCAGGTGGATTTGGGCTGTAACTTCTTCGTTGACACAGTGGTCCCAGATACTTCACGC
  ATCTATGTGGCCCTGGGATATGGTTTTTTCCTGGAGTTGACACTGGCAGAAGCTCTCAAG
  TTCATTGATCGTAAGAGCTCTCTCCTCACAGAGCTCAGCAACAGCCTCACCAAGGACTCC
  ATGAATATCAAAGCCCATATCCACATGTTGCTAGAGGGGCTTAGAGAACTACAAGGCCTG
  CAGAATTTCCCAGAGAAGCCTCACCATTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_153477
• ORF Size: 510 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_153477.1, NP_705582.1
• RefSeq Size: 734
• RefSeq ORF: 510
• Locus ID: 8409
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene functions as a cofactor that modulates androgen receptor-dependent transcription, and also plays a critical role in tumor necrosis factor-induced apoptosis. Expression of this gene may play a role in tumorigenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).