RGS20 (NM_170587) Human Untagged Clone

CAT#: SC306672

RGS20 (untagged)-Human regulator of G-protein signaling 20 (RGS20), transcript variant 1


  "NM_170587" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RGS20"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RGS20
Synonyms g(z)GAP; gz-GAP; RGSZ1; ZGAP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_170587, the custom clone sequence may differ by one or more nucleotides


ATGCCCCAGCTTTCCCAAGATAACCAAGAGTGCCTCCAGAAACATTTCTCCAGGCCGTCTATATGGACAC
AGTTTCTGCCCCTGTTCAGGGCTCAGAGATATAATACAGACATTCACCAAATCACAGAAAATGAAGGAGA
CCTCAGGGCTGTTCCTGATATCAAGTCCTTCCCGCCTGCACAGCTCCCAGACTCGCCCGCCGCCCCGAAG
CTGTTCGGCCTCCTTTCTAGCCCGCTTTCCAGCCTCGCAAGGTTCTTCTCTCACCTTCTCCGGCGACCCC
CTCCCGAGGCTCCCCGGAGGCGCCTGGACTTCTCCCCCCTGCTTCCCGCCCTGCCGGCCGCCCGGCTCTC
GAGGGGGCACGAGGAGCTGCCGGGCCGCCTCTCGCTCCTGCTCGGGGCGGCGCTGGCACTGCCCGGCCGA
CCCTCGGGGGGTCGTCCGCTGAGGCCCCCCCATCCGGTAGCCAAGCCCAGGGAAGAAGACGCCACCGCTG
GGCAGAGCTCGCCTATGCCGCAGATGGGATCAGAGCGGATGGAGATGCGGAAGCGGCAGATGCCCGCCGC
CCAGGACACACCAGGCGCCGCCCCAGGCCAGCCCGGAGCGGGGAGTCGCGGGTCCAACGCATGCTGCTTC
TGCTGGTGCTGCTGTTGTAGCTGCTCGTGTCTCACTGTTAGAAACCAGGAAGATCAGAGGCCCACAATAG
CTTCCCACGAACTCAGAGCAGATCTTCCAACCTGGGAAGAAAGCCCTGCTCCTACTCTGGAAGAAGTCAA
CGCCTGGGCTCAGTCATTTGACAAATTAATGGTCACTCCAGCAGGAAGGAATGCATTCCGTGAATTCCTC
CGAACAGAATTCAGTGAGGAAAATATGCTCTTCTGGATGGCCTGTGAGGAACTGAAAAAGGAAGCTAATA
AAAACATTATTGAAGAGAAAGCAAGGATAATCTATGAAGACTACATTTCTATACTTTCTCCTAAGGAGGT
GAGCTTAGACTCCCGGGTGAGAGAAGTGATCAACAGAAACATGGTGGAGCCATCCCAACACATATTCGAT
GATGCTCAACTTCAGATTTACACCCTGATGCACAGAGACTCATATCCTCGATTCATGAACTCTGCTGTCT
ATAAGGACTTGCTTCAGTCCTTATCGGAGAAATCTATTGAAGCATAG


Restriction Sites SgfI-MluI     
ACCN NM_170587
ORF Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_170587.3, NP_733466.1
RefSeq Size 2105
RefSeq ORF 1167
Locus ID 8601
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.