Junctophilin 2 (JPH2) (NM_175913) Human Untagged Clone

CAT#: SC307053

JPH2 (untagged)-Human junctophilin 2 (JPH2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: JPH2
• Synonyms: CMH17; JP-2; JP2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_175913, the custom clone sequence may differ by one or more nucleotides
  ATGAGTGGGGGCCGCTTCGACTTTGATGATGGAGGGGCGTACTGCGGGGGCTGGGAGGGG
  GGAAAGGCCCATGGGCATGGACTGTGCACAGGCCCCAAGGGCCAGGGCGAATACTCTGGC
  TCCTGGAACTTTGGCTTTGAGGTGGCAGGTGTCTACACCTGGCCCAGCGGAAACACCTTT
  GAGGGATACTGGAGCCAGGGCAAACGGCATGGGCTGGGCATAGAGACCAAGGGGCGCTGG
  CTCTACAAGGGCGAGTGGACACATGGCTTCAAGGGACGCTACGGAATCCGGCAGAGCTCA
  AGCAGCGGTGCCAAGTATGAGGGCACCTGGAACAATGGCCTGCAAGACGGCTATGGCACC
  GAGACCTATGCTGATGGAGGGATGTGTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_175913
• ORF Size: 390 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_175913.3, NP_787109.2
• RefSeq Size: 2408
• RefSeq ORF: 390
• Locus ID: 57158
• Protein Families: Transmembrane
• Gene Summary: Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. Alternative splicing has been observed at this locus and two variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1.