LYNX1 (NM_177457) Human Untagged Clone

CAT#: SC307097

LYNX1 (untagged)-Human Ly6/neurotoxin 1 (LYNX1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LYNX1
• Synonyms: SLURP2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_177457, the custom clone sequence may differ by one or more nucleotides
  ATGACGCCCCTGCTCACCCTGATCCTGGTGGTCCTCATGGGCTTACCTCTGGCCCAGGCC
  TTGGACTGCCACGTGTGTGCCTACAACGGAGACAACTGCTTCAACCCCATGCGCTGCCCG
  GCTATGGTTGCCTACTGCATGACCACGCGCACCTACTACACCCCCACCAGGATGAAGGTC
  AGTAAGTCCTGCGTGCCCCGCTGCTTCGAGACTGTGTATGATGGCTACTCCAAGCACGCG
  TCCACCACCTCCTGCTGCCAGTACGACCTCTGCAACGGCACCGGCCTTGCCACCCCGGCC
  ACCCTGGCCCTGGCCCCCATCCTCCTGGCCACCCTCTGGGGTCTCCTCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_177457
• ORF Size: 351 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_177457.2, NP_803252.1
• RefSeq Size: 1021
• RefSeq ORF: 351
• Locus ID: 66004
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a GPI-anchored, cell membrane bound member of the Ly6/uPAR (LU) superfamily of proteins containing the unique three-finger LU domain. This protein interacts with nicotinic acetylcholine receptors (nAChRs), and is thought to function as a modulator of nAChR activity to prevent excessive excitation. Alternatively spliced transcript variants have been found for this gene. Read-through transcription between this gene and the neighboring downstream gene (SLURP2) generates naturally-occurring transcripts (LYNX1-SLURP2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Sep 2017]
  Transcript Variant: This variant (3) differs in the 3' UTR and in the coding region, compared to variant 1. The resulting isoform (c) is shorter, and has a distinct C-terminus when compared to isoform a. Isoform c is encoded by transcript variants 3, 4 and 5.