SULT1A1 (NM_177536) Human Untagged Clone

CAT#: SC307103

SULT1A1 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 5


  "NM_177536" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SULT1A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SULT1A1
Synonyms HAST1/HAST2; P-PST; PST; ST1A1; ST1A3; STP; STP1; TSPST1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_177536, the custom clone sequence may differ by one or more nucleotides


ATGCTGGCCAAGTTGCTGTGCGACCAGGTGGTCGGTGCGCCCATCGCGGTCTCGGCCTTCTACGCCGGTA
TGAGCATTCTCCAGGGAAAGGATGACATATTTTTGGACCTGAAACAGAAATTCTGGAACACCTATATGGT
GGTCTATGTTGCCCGCAACGCAAAGGATGTGGCAGTTTCCTACTACCACTTCTACCACATGGCCAAGGTG
CACCCTGAGCCTGGGACCTGGGACAGCTTCCTGGAGAAGTTCATGGTCGGAGAAGTGTCCTACGGATCCT
GGTACCAGCACGTGCAGGAGTGGTGGGAGCTGAGCCGCACCCACCCTGTTCTCTACCTCTTCTATGAAGA
CATGAAGGAGAACCCGAAAAGGGAGATTCAAAAGATCCTGGAGTTTGTGGGGCGCTCCCTGCCAGAGGAG
ACCGTGGACTTCGTGGTTCAGCACACGTCGTTCAAGGAGATGAAGAAGAACCCTATGACCAACTACACCA
CCGTCCCCCAGGAGTTCATGGACCACAGCATCTCCCCCTTCATGAGGAAAGGCATGGCTGGGGACTGGAA
GACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTATGCGGAGAAGATGGCAGGCTGCAGC
CTCAGCTTCCGCTCTGAGCTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_177536
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177536.3, NP_803880.1
RefSeq Size 1291 bp
RefSeq ORF 654 bp
Locus ID 6817
Cytogenetics 16p11.2
Protein Pathways Sulfur metabolism
Gene Summary 'Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Multiple alternatively spliced variants that encode two isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (5) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1, which causes the predicted protein (isoform b) to be shorter than isoform a. The predicted ORF of this rare transcript has not been experimentally confirmed.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.