PPAP2C (PLPP2) (NM_177543) Human Untagged Clone

CAT#: SC307107

PPAP2C (untagged)-Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 3


  "NM_177543" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLPP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLPP2
Synonyms LPP2; PAP-2c; PAP2-g; PPAP2C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_177543, the custom clone sequence may differ by one or more nucleotides


ATGGGGGTCGCGAGAGGCCCGGGGAGCCGGGGCCAGCATCCCCCGCCCCGGCAGCAGGAAGTCTGTGCGG
AGGGGCCGCGCGCGCGCCTCCATCCCGCCCCGCCTGGCCTGGGAGCCTCCCTGCCCTTCGCTATCCTGAC
GCTGGTGAACGCCCCGTACAAGCGAGGATTTTACTGCGGGGATGACTCCATCCGGTACCCCTACCGTCCA
GATACCATCACCCACGGGCTCATGGCTGGGGTCACCATCACGGCCACCGTCATCCTTGTCTCGGCCGGGG
AAGCCTACCTGGTGTACACAGACCGGCTCTATTCTCGCTCGGACTTCAACAACTACGTGGCTGCTGTATA
CAAGGTGCTGGGGACCTTCCTGTTTGGGGCTGCCGTGAGCCAGTCTCTGACAGACCTGGCCAAGTACATG
ATTGGGCGTCTGAGGCCCAACTTCCTAGCCGTCTGCGACCCCGACTGGAGCCGGGTCAACTGCTCGGTCT
ATGTGCAGCTGGAGAAGGTGTGCAGGGGAAACCCTGCTGATGTCACCGAGGCCAGGTTGTCTTTCTACTC
GGGACACTCTTCCTTTGGGATGTACTGCATGGTGTTCTTGGCGCTGTATGTGCAGGCACGACTCTGTTGG
AAGTGGGCACGGCTGCTGCGACCCACAGTCCAGTTCTTCCTGGTGGCCTTTGCCCTCTACGTGGGCTACA
CCCGCGTGTCTGATTACAAACACCACTGGAGCGATGTCCTTGTTGGCCTCCTGCAGGGGGCACTGGTGGC
TGCCCTCACTGTCTGCTACATCTCAGACTTCTTCAAAGCCCGACCCCCACAGCACTGTCTGAAGGAGGAG
GAGCTGGAACGGAAGCCCAGCCTGTCACTGACGTTGACCCTGGGCGAGGCTGACCACAACCACTATGGAT
ACCCGCACTCCTCCTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_177543
ORF Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_177543.2, NP_808211.1
RefSeq Size 1387
RefSeq ORF 930
Locus ID 8612
Protein Families Druggable Genome, Stem cell - Pluripotency, Transmembrane
Protein Pathways Ether lipid metabolism, Fc gamma R-mediated phagocytosis, Glycerolipid metabolism, Glycerophospholipid metabolism, Metabolic pathways, Sphingolipid metabolism
Gene Summary The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) encodes the longest isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.