PILRB (NM_178238) Human Untagged Clone
CAT#: SC307145
PILRB (untagged)-Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3
"NM_178238" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PILRB |
Synonyms | FDFACT1; FDFACT2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_178238, the custom clone sequence may differ by one or more nucleotides
ATGGGTCGGCCCCTGCTGCTGCCCCTGCTGCTCCTGCTGCAGCCGCCAGCATTTCTGCAGCCTGGTGGCT CCACAGGATCTGGTCCAAGCTACCTTTATGGGGTCACTCAACCAAAACACCTCTCAGCCTCCATGGGTGG CTCTGTGGAAATCCCCTTCTCCTTCTATTACCCCTGGGAGTTAGCCATAGTTCCCAACGTGAGAATATCC TGGAGACGGGGCCACTTCCACGGGCAGTCCTTCTACAGCACAAGGCCGCCTTCCATTCACAAGGATTATG TGAACCGGCTCTTTCTGAACTGGACAGAGGGTCAGGAGAGCGGCTTCCTCAGGATCTCAAACCTGCGGAA GGAGGACCAGTCTGTGTATTTCTGCCGAGTCGAGCTGGACACCCGGAGATCAGGGAGGCAGCAGTTGCAG TCCATCAAGGGGACCAAACTCACCATCACCCAGGCTGTCACAACCACCACCACCTGGAGGCCCAGCAGCA CAACCACCATAGCCGGCCTCAGGGTCACAGAAAGCAAAGGGCACTCAGAATCATGGCACCTAAGTCTGGA CACTGCCATCAGGGTTGCATTGGCTGTCGCTGTGCTCAAAACTGTCATTTTGGGACTGCTGTGCCTCCTC CTCCTGTGGTGGAGGAGAAGGAAAGGTAGCAGGGCGCCAAGCAGTGACTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_178238 |
ORF Size | 684 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_178238.3, NP_839956.1 |
RefSeq Size | 1438 |
RefSeq ORF | 684 |
Locus ID | 29990 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function. [provided by RefSeq, Jun 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222631 | PILRB (Myc-DDK-tagged)-Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3 |
USD 420.00 |
|
RG222631 | PILRB (GFP-tagged) - Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3 |
USD 460.00 |
|
RC222631L3 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC222631L4 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review