U1SNRNPBP (SNRNP35) (NM_180699) Human Untagged Clone

CAT#: SC307238

SNRNP35 (untagged)-Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SNRNP35
• Synonyms: HM-1; U1SNRNPBP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_180699, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAACCAGCTAACATGAACGATTGGATGCCCATCGCCAAGGAGTATGATCCACTCAAAGCGGGCAGCA
  TTGATGGCACCGATGAAGACCCACACGACCGCGCGGTCTGGAGGGCAATGCTGGCACGATATGTCCCCAA
  CAAAGGTGTCATAGGAGATCCCCTCCTCACCCTGTTTGTGGCCAGACTAAACTTGCAGACCAAGGAGGAC
  AAATTAAAGGAAGTCTTTTCCCGCTATGGTGACATCCGGCGGCTTCGGCTGGTCAGGGACTTGGTCACAG
  GTTTTTCAAAGGGCTACGCCTTCATCGAATACAAGGAGGAGCGTGCCGTGATCAAAGCTTACCGAGATGC
  TGATGGCCTGGTTATTGACCAGCATGAGATATTTGTGGACTACGAGCTGGAAAGGACTCTCAAAGGGTGG
  ATCCCTCGGCGACTTGGAGGCGGTCTTGGGGGAAAAAAGGAGTCTGGGCAACTGAGATTTGGGGGACGGG
  ACCGGCCTTTTCGAAAACCTATTAACTTGCCAGTTGTTAAAAACGACCTCTATAGAGAGGGAAAACGGGA
  AAGGCGGGAGCGATCTCGATCCCGAGAAAGACACTGGGACTCGAGGACAAGGGATCGAGACCATGACAGG
  GGCCGGGAGAAGAGATGGCAAGAAAGAGAGCCGACCAGGGTGTGGCCCGACAATGACTGGGAGAGAGAGA
  GGGACTTCAGAGATGACAGGATCAAGGGGAGGGAGAAGAAGGAAAGAGGCAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_180699
• ORF Size: 756 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_180699.3, NP_851030.1
• RefSeq Size: 1070
• RefSeq ORF: 756
• Locus ID: 11066
• Gene Summary: The protein encoded by this gene is a homolog of the U1-snRNP binding protein. The N-terminal half contains a RNA recognition motif and the C-terminal half is rich in Arg/Asp and Arg/Glu dipeptides, which is a characteristic of a variety of splicing factors. This protein is a component of the U11/U12 small nuclear ribonucleoproteins (snRNP) that form part of the U12-type spliceosome. Alternative splicing results in multiple transcript variants encoding two distinct isoforms and representing a non-protein coding variant. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (3) includes an alternate exon and initiates translation at an alternate start codon, compared to variant 2. The full extent of the 5' UTR of this variant has not been determined. The encoded isoform (b) has a longer N-terminus, compared to isoform a.