FOXR1 (NM_181721) Human Untagged Clone

CAT#: SC307354

FOXR1 (untagged)-Human forkhead box R1 (FOXR1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FOXR1
• Synonyms: DLNB13; FOXN5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181721, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGAACGAGCTCTTTCTGGCCTTCACCACATCTCACCTCCCCTTAGCGGAGCAGAAACTTGCCAGGT
  ATAAACTCCGAATTGTTAAGCCACCAAAATTACCCCTAGAGAAAAAACCCAACCCTGATAAGGATGGTCC
  AGATTATGAGCCCAACCTCTGGATGTGGGTAAATCCCAACATTGTGTATCCCCCTGGAAAGCTGGAGGTC
  TCAGGACGTAGGAAGAGGGAGGACCTGACAAGCACACTCCCCTCCTCTCAGCCACCCCAGAAGGAGGAAG
  ATGCCAGCTGCTCAGAGGCCGCAGGGGTGGAATCACTGTCCCAGTCCTCCAGCAAGCGGTCTCCCCCTCG
  GAAGCGGTTTGCCTTTTCCCCCAGCACCTGGGAGCTCACAGAAGAGGAGGAGGCTGAGGACCAGGAAGAC
  AGCTCCTCTATGGCTCTCCCATCCCCTCACAAAAGGGCCCCCCTCCAGAGTCGGAGGCTTCGGCAAGCCA
  GCAGCCAGGCGGGGAGGCTCTGGTCCCGGCCCCCTCTCAATTACTTCCACCTAATTGCCCTGGCATTAAG
  AAACAGTTCCCCCTGTGGCCTCAACGTGCAACAGATCTACAGTTTCACTCGAAAGCACTTCCCCTTTTTC
  CGGACGGCCCCGGAAGGCTGGAAGAATACTGTCCGTCACAATCTCTGTTTTCGAGACAGCTTTGAGAAAG
  TGCCTGTCAGCATGCAGGGCGGGGCCAGCACACGGCCTCGATCTTGCCTCTGGAAGTTGACCGAGGAGGG
  ACACCGCCGCTTTGCGGAGGAGGCCCGCGCCTTGGCTTCCACTCGGCTAGAAAGTATCCAACAGTGCATG
  AGCCAGCCAGATGTGATGCCCTTCCTCTTTGATCTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_181721
• ORF Size: 879 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_181721.2, NP_859072.1
• RefSeq Size: 1215
• RefSeq ORF: 879
• Locus ID: 283150
• Gene Summary: This gene encodes a member of the forkhead box (FOX) family of transcription factors. FOX family members are monomeric, helix-turn-helix proteins with a core DNA-binding domain of approximately 110 aa. Many FOX transcription factors play roles in determining cell fates during early development. This forkhead box protein lacks the C-terminal basic region found in many other FOX family members. It is located within the 11q23.3 region which is commonly deleted in neuroblastomas. [provided by RefSeq, Jul 2008]