BOULE (BOLL) (NM_197970) Human Untagged Clone

CAT#: SC307621

BOLL (untagged)-Human bol, boule-like (Drosophila) (BOLL), transcript variant 1


  "NM_197970" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BOLL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BOLL
Synonyms BOULE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_197970, the custom clone sequence may differ by one or more nucleotides


ATGGAAACCGAGTCCGGGCCGCAAACATCAAACCAGATGCAAACAGATTCATTATCTCCATCCCCTAATC
CTGTGTCACCTGTGCCTTTGAATAACCCAACAAGTGCCCCAAGATATGGAACAGTGATCCCTAATCGCAT
CTTTGTAGGAGGAATTGATTTTAAGACAAACGAAAGTGATTTAAGAAAATTTTTTTCCCAGTATGGGTCT
GTGAAAGAAGTGAAGATTGTAAATGACAGAGCTGGAGTATCCAAAGGGTATGGTTTCGTCACTTTTGAAA
CACAAGAAGATGCACAAAAAATTTTACAAGAGGCTGAAAAACTTAATTATAAGGATAAGAAGCTGAACAT
TGGTCCAGCAATAAGAAAACAACAAGTAGGGATCCCTCGTTCTAGTATAATGCCAGCAGCTGGAACAATG
TATCTAACAACTTCAACTGGATATCCTTATACTTACCATAATGGTGTTGCTTATTTTCATACTCCAGAGG
TAACTTCGGTCCCACCGCCTTGGCCTTCACGTTCTGTATGTAGCTCCCCTGTGATGGTAGCTCAGCCCAT
TTATCAGCAACCTGCATATCACTACCAGGCCACCACACAGTATTTACCAGGACAGTGGCAGTGGAGTGTT
CCTCAGCCTTCTGCCTCTTCTGCTCCATTCTTATACCTGCAACCTTCTGAGGTTATTTATCAACCAGTGG
AAATTGCACAGGATGGTGGATGTGTTCCTCCTCCACTGTCTCTGATGGAAACTTCAGTTCCAGAGCCTTA
TTCTGATCATGGAGTTCAAGCAACATATCACCAGGTTTATGCTCCAAGTGCCATCACTATGCCTGCGCCT
GTGATGCAGCCTGAGCCAATTAAAACAGTGTGGAGCATTCATTATTAA


Restriction Sites SgfI-MluI     
ACCN NM_197970
ORF Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_197970.2, NP_932074.1
RefSeq Size 2779
RefSeq ORF 888
Locus ID 66037
Gene Summary This gene belongs to the DAZ gene family required for germ cell development. It encodes an RNA-binding protein which is more similar to Drosophila Boule than to human proteins encoded by genes DAZ (deleted in azoospermia) or DAZL (deleted in azoospermia-like). Loss of this gene function results in the absence of sperm in semen (azoospermia). Histological studies demonstrated that the primary defect is at the meiotic G2/M transition. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.