QRFP (NM_198180) Human Untagged Clone

CAT#: SC307641

QRFP (untagged)-Human pyroglutamylated RFamide peptide (QRFP)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: QRFP
• Synonyms: 26RFa; P518
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_198180, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTAAGGCCTTACCCCCTGATCTACTTCCTCTTCCTGCCGCTGGGCGCCTGCTTCCCTCTACTGGACA
  GAAGAGAGCCCACAGACGCCATGGGTGGCCTCGGAGCTGGAGAACGCTGGGCCGACCTGGCCATGGGGCC
  CCGACCCCACTCCGTGTGGGGTTCCTCTCGGTGGCTGAGAGCTTCACAGCCACAGGCCCTGCTTGTCATA
  GCCAGGGGGCTGCAGACATCGGGCAGAGAGCATGCTGGCTGCAGATTCCGCTTCGGGAGGCAGGACGAAG
  GCAGTGAGGCCACCGGCTTCCTCCCTGCTGCGGGGGAGAAGACCAGCGGCCCGTTAGGGAACCTGGCTGA
  GGAGCTCAATGGCTACAGCAGGAAGAAAGGCGGCTTCAGCTTCCGCTTCGGTCGGCGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_198180
• ORF Size: 411 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_198180.2, NP_937823.1
• RefSeq Size: 932
• RefSeq ORF: 411
• Locus ID: 347148
• Gene Summary: This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. The encoded products are members of the RFamide family of neuropeptides, characterized by their common protein C-terminus consisting of an arginine (R) and an amidated phenylalanine (F). These products include the neuropeptides 26RFa and the N-terminally extended form, 43RFa. Both of these neuropeptides bind to the pyroglutamylated RFamide peptide receptor (QRFPR) and may regulate blood pressure, reproduction and food intake in rodents. [provided by RefSeq, Jul 2015]