LHFPL4 (NM_198560) Human Untagged Clone

CAT#: SC307750

LHFPL4 (untagged)-Human lipoma HMGIC fusion partner-like 4 (LHFPL4)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LHFPL4
• Synonyms: GARLH4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_198560, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCCCTCGCAGGAGGCCTCCAAGCTCTACCACGAGCACTACATGCGGAACTCGCGGGCCATCGGCG
  TGCTGTGGGCCATCTTCACCATCTGCTTCGCCATCATCAACGTGGTGGTCTTCATCCAGCCCTACTGGGT
  GGGCGACAGCGTGAGCACCCCCAAGCCTGGCTACTTCGGCCTCTTCCACTACTGCGTGGGCAGCGGGCTG
  GCGGGCCGCGAGCTCACCTGCCGGGGCTCCTTCACCGACTTCAGCACCATCCCGTCCAGCGCCTTCAAGG
  CGGCCGCCTTCTTCGTGCTGCTCTCCATGGTGCTGATCCTCGGCTGCATCACCTGCTTTTCGCTTTTCTT
  CTTCTGCAACACGGCTACGGTCTACAAGATCTGCGCCTGGATGCAGCTCTTGGCAGCTCTGTGCCTCGTC
  CTGGGCTGCATGATCTTTCCTGATGGCTGGGATGCCGAGACCATCCGGGACATGTGTGGGGCCAAGACGG
  GGAAGTACTCCCTGGGGGACTGTTCAGTGCGCTGGGCATACATCCTGGCCATCATCGGCATCCTCAACGC
  CCTCATCCTCTCCTTCCTCGCCTTCGTGCTGGGCAACCGGCAAACAGACCTGCTGCAGGAGGAGCTCAAG
  CCGGAGAACAAAGATTTTGTGGGCTCTACAGTAAGCTCCGTGTTGCGGCCCGGGGGTGATGTCTCTGGAT
  GGGGAGTCCTTCCCTGCCCCGTGGCTCACTCACAGGGACCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_198560
• ORF Size: 744 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_198560.2, NP_940962.1
• RefSeq Size: 4895
• RefSeq ORF: 744
• Locus ID: 375323
• Protein Families: Transmembrane
• Gene Summary: This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. [provided by RefSeq, Jul 2008]