SFTPB (NM_198843) Human Untagged Clone

CAT#: SC307793

SFTPB (untagged)-Human surfactant protein B (SFTPB), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SFTPB
• Synonyms: PSP-B; SFTB3; SFTP3; SMDP1; SP-B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_198843, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCACCAAGCAGGGTACCCAGGCTGCAGAGGTGCCATGGCTGAGTCACACCTGCTGCAGTGGCTGCTGC
  TGCTGCTGCCCACGCTCTGTGGCCCAGGCACTGCTGCCTGGACCACCTCATCCTTGGCCTGTGCCCAGGG
  CCCTGAGTTCTGGTGCCAAAGCCTGGAGCAAGCATTGCAGTGCAGAGCCCTAGGGCATTGCCTACAGGAA
  GTCTGGGGACATGTGGGAGCCGATGACCTATGCCAAGAGTGTGAGGACATCGTCCACATCCTTAACAAGA
  TGGCCAAGGAGGCCATTTTCCAGGACACGATGAGGAAGTTCCTGGAGCAGGAGTGCAACGTCCTCCCCTT
  GAAGCTGCTCATGCCCCAGTGCAACCAAGTGCTTGACGACTACTTCCCCCTGGTCATCGACTACTTCCAG
  AACCAGACTGACTCAAACGGCATCTGTATGCACCTGGGCCTGTGCAAATCCCGGCAGCCAGAGCCAGAGC
  AGGAGCCAGGGATGTCAGACCCCCTGCCCAAACCTCTGCGGGACCCTCTGCCAGACCCTCTGCTGGACAA
  GCTCGTCCTCCCTGTGCTGCCCGGGGCCCTCCAGGCGAGGCCTGGGCCTCACACACAGGATCTCTCCGAG
  CAGCAATTCCCCATTCCTCTCCCCTATTGCTGGCTCTGCAGGGCTCTGATCAAGCGGATCCAAGCCATGA
  TTCCCAAGGGTGCGCTAGCTGTGGCAGTGGCCCAGGTGTGCCGCGTGGTACCTCTGGTGGCGGGCGGCAT
  CTGCCAGTGCCTGGCTGAGCGCTACTCCGTCATCCTGCTCGACACGCTGCTGGGCCGCATGCTGCCCCAG
  CTGGTCTGCCGCCTCGTCCTCCGGTGCTCCATGGATGACAGCGCTGGCCCAAGGTCGCCGACAGGAGAAT
  GGCTGCCGCGAGACTCTGAGTGCCACCTCTGCATGTCCGTGACCACCCAGGCCGGGAACAGCAGCGAGCA
  GGCCATACCACAGGCAATGCTCCAGGCCTGTGTTGGCTCCTGGCTGGACAGGGAAAAGTGCAAGCAATTT
  GTGGAGCAGCACACGCCCCAGCTGCTGACCCTGGTGCCCAGGGGCTGGGATGCCCACACCACCTGCCAGG
  CCCTCGGGGTGTGTGGGACCATGTCCAGCCCTCTCCAGTGTATCCACAGCCCCGACCTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_198843
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_198843.2, NP_942140.2
• RefSeq Size: 2854 bp
• RefSeq ORF: 1182 bp
• Locus ID: 6439
• Cytogenetics: 2p11.2
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]'
  Transcript Variant: This variant (2) lacks an internal segment in the 3' UTR, as compared to variant 1. Both variants 1 and 2 encode the same protein.