VAX1 (NM_199131) Human Untagged Clone

CAT#: SC307872

VAX1 (untagged)-Human ventral anterior homeobox 1 (VAX1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VAX1
• Synonyms: MCOPS11
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199131, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCGGGAAACCAGACAAAATGGACGTTCGATGCCACTCGGACGCCGAGGCTGCCCGGGTCTCGAAGA
  ACGCGCACAAGGAGAGTCGGGAGAGCAAGGGCGCGGAGGGGAACCTCCCAGCCGCCTTCCTCAAGGAGCC
  GCAGGGCGCCTTCTCAGCGTCGGGCGCTGCTGAGGATTGTAACAAAAGTAAATCCAATTCCGCAGCGGAC
  CCGGATTACTGCCGCCGGATCCTGGTCCGAGATGCCAAGGGGTCCATCCGAGAGATCATCCTGCCCAAGG
  GCCTGGACTTGGACCGGCCTAAGAGGACGCGCACGTCCTTCACCGCGGAGCAGCTCTATCGGCTGGAGAT
  GGAGTTCCAGCGCTGCCAGTACGTGGTGGGCCGCGAGAGGACCGAGCTCGCCCGGCAGCTTAACCTCTCC
  GAGACCCAGGCAAATAGTGAAGAAAATAATGAACGATTCAAACGCGGGATAAAAAAACAAAAGAAGAAAA
  GGAAGAAAGAGCCAGCAAATGATGAGTCTCGGCGTGGGGACTCCGGGGGCAGAGGGTGGCAGCCCCTATA
  G
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199131
• ORF Size: 561 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199131.2, NP_954582.1
• RefSeq Size: 4494
• RefSeq ORF: 561
• Locus ID: 11023
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a homeo-domain containing protein from a class of homeobox transcription factors which are conserved in vertebrates. Genes of this family are involved in the regulation of body development and morphogenesis. The most conserved genes, called HOX genes are found in special gene clusters. This gene belongs to the VAX subfamily and lies in the vicinity of the EMX homeobox gene family. Another member of VAX family is located on chromosome 2. The encoded protein may play an important role in the development of anterior ventral forebrain and visual system. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting isoform (b) has a shorter C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by orthologous data.