PRB1 (NM_199354) Human Untagged Clone
CAT#: SC307953
PRB1 (untagged)-Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 3
"NM_199354" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | PRB1 |
| Synonyms | PM; PMF; PMS; PRB1L; PRB1M |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_199354 edited
GCCCTTGCACAGAGTTGGGAGTGACTCCAGAGCCTCCTGCAAGATGCTGTTGATTCTGCT GTCAGTGGCCTTGCTGGCCCTGAGCTCAGCTCAGAACTTAAATGAAGATGTCAGCCAGGA AGAATCTCCCTCCCTAATAGCAGGAAATCCACAAGGACCATCCCCACAAGGAGGCAACAA GCCCCAAGGCCCCCCACCTCCTCCAGGAAAGCCACAAGGACCACCCCCACAAGGAGGCAA CAAACCTCAAGGTCCCCTACCTCCAGGAAAGCCACAAGGACCACCCCCACAAGGGGACAA GTCCCGAAGTCCCCGATCTCCTCCAGGAAAACCACAAGGACCACCCCCACAAGGAGGAAA GCCACAAGGACCACCCGCACAAGGAGGCAGCAAGTCCCAAAGTGCCCGAGCTCCTCCAGG AAAGCCACAAGGACCACCCCAACAAGAAGGCAACAATCCTCAAGGTCCCCCACCTCCAGC AGGAGGCAATCCCCAGCAGCCTCAGGCACCTCCTGCTGGACAGCCCCAGGGACCACCACG CCCTCCTCAAGGGGGCAGACCTTCCAGACCTCCCCAGTGACAGCCTCCCCAGTCATCTAG G |
| Restriction Sites | Please inquire |
| ACCN | NM_199354 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_199354.1. Another C to T change was found at position of 258, which changes amono acid from P to L. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_199354.1, NP_955386.1 |
| RefSeq Size | 714 bp |
| RefSeq ORF | 537 bp |
| Locus ID | 5542 |
| Cytogenetics | 12p13.2 |
| Protein Families | Druggable Genome |
| Gene Summary | 'This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Medium" allele. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]' Transcript Variant: This variant (3) lacks an in-frame segment within the coding region compared to variant 1. The resulting isoform (3) lacks an internal region, compared to isoform 1. This isoform (3) may undergo proteolytic processing similar to isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219911 | PRB1 (Myc-DDK-tagged)-Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 3 |
USD 300.00 |
|
| RG219911 | PRB1 (GFP-tagged) - Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 3 |
USD 460.00 |
|
| RC219911L1 | Lenti ORF clone of Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
| RC219911L2 | Lenti ORF clone of Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 3, mGFP tagged |
USD 620.00 |
|
| RC219911L3 | Lenti ORF clone of Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
| RC219911L4 | Lenti ORF clone of Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China