Spastin (SPAST) (NM_199436) Human Untagged Clone

CAT#: SC307972

SPAST (untagged)-Human spastin (SPAST), transcript variant 2


  "NM_199436" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SPAST"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPAST
Synonyms ADPSP; FSP2; SPG4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_199436, the custom clone sequence may differ by one or more nucleotides


ATGAATTCTCCGGGTGGACGAGGGAAGAAGAAAGGCTCCGGCGGCGCCAGCAACCCGGTGCCTCCCAGGC
CTCCGCCCCCTTGCCTGGCCCCCGCCCCTCCCGCCGCCGGGCCGGCCCCTCCGCCCGAGTCGCCGCATAA
GCGGAACCTGTACTATTTCTCCTACCCGCTGTTTGTAGGCTTCGCGCTGCTGCGTTTGGTCGCCTTCCAC
CTGGGGCTCCTCTTCGTGTGGCTCTGCCAGCGCTTCTCCCGCGCCCTCATGGCAGCCAAGAGGAGCTCCG
GGGCCGCGCCAGCACCTGCCTCGGCCTCGGCCCCGGCGCCGGTGCCGGGCGGCGAGGCCGAGCGCGTCCG
AGTCTTCCACAAACAGGCCTTCGAGTACATCTCCATTGCCCTGCGCATCGATGAGGATGAGAAAGCAGGA
CAGAAGGAGCAAGCTGTGGAATGGTATAAGAAAGGTATTGAAGAACTGGAAAAAGGAATAGCTGTTATAG
TTACAGGACAAGGTGAACAGTGTGAAAGAGCTAGACGCCTTCAAGCTAAAATGATGACTAATTTGGTTAT
GGCCAAGGACCGCTTACAACTTCTAGAAAGTGGAGCTGTTCCAAAAAGAAAAGACCCCTTAACACACACT
AGTAATTCACTGCCTCGTTCAAAAACAGTTATGAAAACTGGATCTGCAGGCCTTTCAGGCCACCATAGAG
CACCTAGTTACAGTGGTTTATCCATGGTTTCTGGAGTGAAACAGGGATCTGGTCCTGCTCCTACCACTCA
TAAGGGTACTCCGAAAACAAATAGGACAAATAAACCTTCTACCCCTACAACTGCTACTCGTAAGAAAAAA
GACTTGAAGAATTTTAGGAATGTGGACAGCAACCTTGCTAACCTTATAATGAATGAAATTGTGGACAATG
GAACAGCTGTTAAATTTGATGATATAGCTGGTCAAGACTTGGCAAAACAAGCATTGCAAGAAATTGTTAT
TCTTCCTTCTCTGAGGCCTGAGTTGTTCACAGGGCTTAGAGCTCCTGCCAGAGGGCTGTTACTCTTTGGT
CCACCTGGGAATGGGAAGACAATGCTGGCTAAAGCAGTAGCTGCAGAATCGAATGCAACCTTCTTTAATA
TAAGTGCTGCAAGTTTAACTTCAAAATACGTGGGAGAAGGAGAGAAATTGGTGAGGGCTCTTTTTGCTGT
GGCTCGAGAACTTCAACCTTCTATAATTTTTATAGATGAAGTTGATAGCCTTTTGTGTGAAAGAAGAGAA
GGGGAGCACGATGCTAGTAGACGCCTAAAAACTGAATTTCTAATAGAATTTGATGGTGTACAGTCTGCTG
GAGATGACAGAGTACTTGTAATGGGTGCAACTAATAGGCCACAAGAGCTTGATGAGGCTGTTCTCAGGCG
TTTCATCAAACGGGTATATGTGTCTTTACCAAATGAGGAGACAAGACTACTTTTGCTTAAAAATCTGTTA
TGTAAACAAGGAAGTCCATTGACCCAAAAAGAACTAGCACAACTTGCTAGAATGACTGATGGATACTCAG
GAAGTGACCTAACAGCTTTGGCAAAAGATGCAGCACTGGGTCCTATCCGAGAACTAAAACCAGAACAGGT
GAAGAATATGTCTGCCAGTGAGATGAGAAATATTCGATTATCTGACTTCACTGAATCCTTGAAAAAAATA
AAACGCAGCGTCAGCCCTCAAACTTTAGAAGCGTACATACGTTGGAACAAGGACTTTGGAGATACCACTG
TTTAA


Restriction Sites SgfI-MluI     
ACCN NM_199436
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_199436.1, NP_955468.1
RefSeq Size 5125 bp
RefSeq ORF 1755 bp
Locus ID 6683
Cytogenetics 2p22.3
Protein Families Druggable Genome, Transmembrane
Gene Summary 'This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The use of alternative translational initiation sites in this gene results in a single transcript variant that can produce isoforms that differ in the length of their N-terminus and which thereby differ in the efficiency of their export from the nucleus to the cytoplasm. In addition, alternative splicing results in multiple transcript variants that encode isoforms that differ in other protein regions as well. One isoform of this gene has been shown to be a microtubule-severing enzyme that regulates microtubule abundance, mobility, and plus-end distribution. Mutations in this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, May 2018]'
Transcript Variant: This variant (2) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (2), compared to isoform 1. This variant is also predicted to use an alternate, in-frame, downstream translation initiation site to encode an even shorter isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.