CNN2 (NM_201277) Human Untagged Clone
CAT#: SC308007
CNN2 (untagged)-Human calponin 2 (CNN2), transcript variant 2
"NM_201277" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CNN2 |
Synonyms | calponin 2; calponin H2, smooth muscle; neutral calponin |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_201277, the custom clone sequence may differ by one or more nucleotides
ATGAGCTCCACGCAGTTCAACAAGGGCCCCTCGTACGGGCTGTCGGCCGAGGTCAAGAACCGGCTCCTGT CCAAATATGACCCCCAGAAGGAGGCAGAGCTCCGCACCTGGATCGAGGGACTCACCGGCCTCTCCATCGG CCCCGACTTCCAGAAGGGCCTGAAGGATGGAACTATCTTATGCACACTCATGAACAAGCTACAGCCGGGC TCCGTCCCCAAGATCAACCGCTCCATGCAGAACTGGCACCAGCTAGAAAACCTGTCCAACTTCATCAAGG CCATGGTCAGCTACGGCATGAACCCTGTGGACCTGTTCGAGGCCAACGACCTGTTTGAGAGTGGGAACAT GACGCAGGTGCAGGTGTCTCTTCTCGCCCTGGCGGGGAAGATGGGCACCAACAAATGCGCCAGCCAGTCG GGCATGACTGCCTACGGCACGAGAAGGCATCTCTATGACCCCAAGAACCATATCCTGCCCCCCATGGACC ACTCGACCATCAGCCTCCAGATGGGCACGAACAAGTGTGCCAGCCAGGTGGGCATGACGGCTCCCGGGAC CCGGCGGCACATCTATGATACCAAGCTGGGAACCGACAAGTGTGACAACTCCTCCATGTCCCTGCAGATG GGCTACACGCAGGGCGCCAACCAGAGCGGCCAGGTCTTCGGCCTGGGCCGGCAGATATATGACCCCAAGT ACTGCCCGCAAGGCACAGTGGCCGATGGGGCTCCCTCGGGCACCGGCGACTGCCCGGACCCGGGGGAGGT CCCTGAATATCCCCCTTACTACCAGGAGGAGGCCGGCTACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_201277 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_201277.2, NP_958434.1 |
RefSeq Size | 2391 bp |
RefSeq ORF | 813 bp |
Locus ID | 1265 |
Cytogenetics | 19p13.3 |
Gene Summary | 'The protein encoded by this gene, which can bind actin, calmodulin, troponin C, and tropomyosin, may function in the structural organization of actin filaments. The encoded protein could play a role in smooth muscle contraction and cell adhesion. Several pseudogenes of this gene have been identified, and are present on chromosomes 1, 2, 3, 6, 9, 11, 13, 15, 16, 21 and 22. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]' Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 4. The encoded isoform (b) is shorter than isoform d. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212208 | CNN2 (Myc-DDK-tagged)-Human calponin 2 (CNN2), transcript variant 2 |
USD 420.00 |
|
RG212208 | CNN2 (GFP-tagged) - Human calponin 2 (CNN2), transcript variant 2 |
USD 460.00 |
|
RC212208L3 | Lenti ORF clone of Human calponin 2 (CNN2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC212208L4 | Lenti ORF clone of Human calponin 2 (CNN2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review