FGL1 (NM_201552) Human Untagged Clone

CAT#: SC308053

FGL1 (untagged)-Human fibrinogen-like 1 (FGL1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGL1
• Synonyms: HFREP1; HP-041; HPS; LFIRE-1; LFIRE1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_201552, the custom clone sequence may differ by one or more nucleotides
  ATGGCAAAGGTGTTCAGTTTCATCCTTGTTACCACCGCTCTGACAATGGGCAGGGAAATT
  TCGGCGCTCGAGGACTGTGCCCAGGAGCAGATGCGGCTCAGAGCCCAGGTGCGCCTGCTT
  GAGACCCGGGTCAAACAGCAACAGGTCAAGATCAAGCAGCTTTTGCAGGAGAATGAAGTC
  CAGTTCCTTGATAAAGGAGATGAGAATACTGTCATTGATCTTGGAAGCAAGAGGCAGTAT
  GCAGATTGTTCAGAGATTTTCAATGATGGGTATAAGCTCAGTGGATTTTACAAAATCAAA
  CCTCTCCAGAGCCCAGCAGAATTTTCTGTTTATTGTGACATGTCCGATGGAGGAGGATGG
  ACTGTAATTCAGAGACGATCTGATGGCAGTGAAAACTTTAACAGAGGATGGAAAGACTAT
  GAAAATGGCTTTGGAAATTTTGTCCAAAAACATGGTGAATATTGGCTGGGCAATAAAAAT
  CTTCACTTCTTGACCACTCAAGAAGACTACACTTTAAAAATCGACCTTGCAGATTTTGAA
  AAAAATAGCCGTTATGCACAATATAAGAATTTCAAAGTTGGAGATGAAAAGAATTTCTAC
  GAGTTGAATATTGGGGAATATTCTGGAACAGCTGGAGATTCCCTTGCGGGGAATTTTCAT
  CCTGAGGTGCAGTGGTGGGCTAGTCACCAAAGAATGAAATTCAGCACGTGGGACAGAGAT
  CATGACAACTATGAAGGGAACTGCGCAGAAGAAGATCAGTCTGGCTGGTGGTTTAACAGG
  TGTCACTCTGCAAACCTGAATGGTGTATACTACAGCGGCCCCTACACGGCTAAAACAGAC
  AATGGGATTGTCTGGTACACCTGGCATGGGTGGTGGTATTCTCTGAAATCTGTGGTTATG
  AAAATTAGGCCAAATGATTTTATTCCAAATGTAATTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_201552
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_201552.1, NP_963846.1
• RefSeq Size: 1412 bp
• RefSeq ORF: 939 bp
• Locus ID: 2267
• Cytogenetics: 8p22
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'Fibrinogen-like 1 is a member of the fibrinogen family. This protein is homologous to the carboxy terminus of the fibrinogen beta- and gamma- subunits which contains the four conserved cysteines of fibrinogens and fibrinogen related proteins. However, this protein lacks the platelet-binding site, cross-linking region and a thrombin-sensitive site which are necessary for fibrin clot formation. This protein may play a role in the development of hepatocellular carcinomas. Four alternatively spliced transcript variants encoding the same protein exist for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) has an alternate exon at the 5' end compared to the longest variant (4). All four variants encode the same protein.