GTF2A1 (NM_201595) Human Untagged Clone

CAT#: SC308068

GTF2A1 (untagged)-Human general transcription factor IIA, 1, 19/37kDa (GTF2A1), transcript variant 2


  "NM_201595" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GTF2A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GTF2A1
Synonyms TF2A1; TFIIA; TFIIA-42; TFIIAL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_201595, the custom clone sequence may differ by one or more nucleotides


ATGGAACTAAAAACTTTATGGGAAAACAAACTAATGCAGTCCAGGGCAGTAGATGGATTTCATTCAGAAG
AGCAGCAGCTTCTACTGCAAGTTCAACAGCAGCATCAACCCCAGCAGCAGCAGCATCACCACCATCACCA
TCATCAGCAAGCTCAGCCTCAGCAGACAGTACCTCAGCAAGCGCAGACCCAGCAGGTTCTTATTCCTGCA
TCACAGCAAGCCACAGCACCACAAGTTATTGTTCCAGATTCTAAGTTGATACAGCATATGAATGCATCAA
ACATGAGTGCTGCTGCTACAGCTGCTACCTTAGCACTCCCTGCAGGTGTGACTCCTGTTCAGCAGATATT
AACAAATTCAGGCCAGCTTCTTCAGGTGGTCAGAGCAGCCAATGGTGCCCAATATATCTTTCAGCCTCAG
CAGTCAGTGGTTCTACAACAACAGGTTATACCACAAATGCAGCCTGGTGGAGTACAAGCTCCTGTTATAC
AGCAGGTGCTGGCTCCTCTTCCTGGAGGGATTTCACCACAGACAGGTGTCATCATCCAGCCTCAGCAAAT
CTTATTTACAGGAAATAAGACTCAAGTTATACCTACGACAGTGGCAGCACCTACACCAGCCCAAGCACAG
ATAACTGCAACTGGCCAGCAGCAACCGCAGGCCCAGCCTGCTCAAACACAAGCTCCATTGGTCTTACAAG
TTGATGGAACTGGGGATACATCATCTGAAGAAGATGAAGATGAAGAAGAAGACTATGATGATGATGAGGA
GGAAGACAAAGAGAAAGATGGAGCTGAAGATGGGCAGGTGGAAGAAGAGCCCCTCAATAGTGAAGATGAT
GTGAGTGATGAGGAAGGACAGGAACTCTTTGACACAGAAAATGTTGTTGTATGCCAATATGATAAGATAC
ACAGAAGTAAAAACAAATGGAAATTTCATCTCAAGGATGGCATTATGAATCTTAATGGAAGAGATTATAT
ATTTTCCAAAGCCATTGGAGATGCAGAATGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_201595
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_201595.2, NP_963889.1
RefSeq Size 5956 bp
RefSeq ORF 1014 bp
Locus ID 2957
Cytogenetics 14q31.1
Protein Families Transcription Factors
Protein Pathways Basal transcription factors
Gene Summary 'Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010]'
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.