ASCL4 (NM_203436) Human Untagged Clone
CAT#: SC308176
ASCL4 (untagged)-Human achaete-scute complex homolog 4 (Drosophila) (ASCL4)
"NM_203436" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ASCL4 |
Synonyms | bHLHa44; HASH4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_203436 edited
TGCACCAGCACCTCTGCTTCTAAGATTCTGTTTCGTCTTCTTCTATTGAGAGATTGACCT CTTGAGTGATTTGTGTGCTTTCCGGCAATTGATGGAGACGCGTAAACCGGCGGAACGGCT GGCCTTGCCATACTCGCTGCGCACCGCGCCCCTGGGCGTTCCGGGGACCCTGCCCGGACT CCCGCGGAGGGACCCCCTCAGGGTCGCCCTGCGTCTGGACGCCGCGTGCTGGGAGTGGGC GCGCAGCGGCTGCGCACGGGGATGGCAGTACTTGCCCGTGCCGCTGGACAGCGCCTTCGA GCCCGCCTTCCTCCGCAAGCGCAACGAGCGCGAGCGGCAGCGGGTGCGCTGCGTGAACGA GGGCTATGCGCGCCTCCGAGACCACCTGCCCCGGGAGCTGGCAGACAAGCGCCTCAGCAA AGTGGAGACGCTCCGCGCTGCCATCGACTACATCAAGCACCTGCAGGAGCTGCTGGAGCG CCAGGCCTGGGGGCTCGAGGGCGCGGCCGGCGCCGTCCCCCAGCGCAGGGCGGAATGCAA CAGCGACGGGGAGTCCAAGGCCTCTTCGGCGCCTTCGCCCAGCAGCGAGCCCGAGGAGGG GGGCAGCTAGCGAGCGCCCGAACTGGCCAGGACCCCCGCGCCCGCCGCACAGCGCGCAGC CGGGCGCTCAACCTAAGGTCCTCTTCGAAGGTGGTTTGCATTCTTAATCTGGCATCTTCT CCAGGCCG |
Restriction Sites | Please inquire |
ACCN | NM_203436 |
ORF Size | 519 bp |
Insert Size | 700 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_203436.1, NP_982260.1 |
RefSeq Size | 2254 |
RefSeq ORF | 519 |
Locus ID | 121549 |
Gene Summary | Basic helix-loop-helix transcription factors, such as ASCL4, are essential for the determination of cell fate and the development and differentiation of numerous tissues (Jonsson et al., 2004 [PubMed 15475265]). [supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC327747 | ASCL4 (untagged)-Human achaete-scute complex homolog 4 (Drosophila) (ASCL4) |
USD 420.00 |
|
RC218928 | ASCL4 (Myc-DDK-tagged)-Human achaete-scute complex homolog 4 (Drosophila) (ASCL4) |
USD 118.00 |
|
RG218928 | ASCL4 (GFP-tagged) - Human achaete-scute complex homolog 4 (Drosophila) (ASCL4) |
USD 460.00 |
|
RC218928L3 | Lenti-ORF clone of ASCL4 (Myc-DDK-tagged)-Human achaete-scute complex homolog 4 (Drosophila) (ASCL4) |
USD 768.00 |
|
RC218928L4 | Lenti-ORF clone of ASCL4 (mGFP-tagged)-Human achaete-scute complex homolog 4 (Drosophila) (ASCL4) |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review