ASCL4 (NM_203436) Human Untagged Clone

CAT#: SC327747

ASCL4 (untagged)-Human achaete-scute complex homolog 4 (Drosophila) (ASCL4)


  "NM_203436" in other vectors (5)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ASCL4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASCL4
Synonyms bHLHa44; HASH4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_203436 edited
TGCACCAGCACCTCTGCTTCTAAGATTCTGTTTCGTCTTCTTCTATTGAGAGATTGACCT
CTTGAGTGATTTGTGTGCTTTCCGGCAAATGATGGAGACGCGTAAACCGGCGGAACGGCT
GGCCTTGCCATACTCGCTGCGCACCGCGCCCCTGGGCGTTCCGGGGACCCTGCCCGGACT
CCCGCGGAGGGACCCCCTCAGGGTCGCCCTGCGTCTGGACGCCGCGTGCTGGGAGTGGGC
GCGCAGCGGCTGCGCACGGGGATGGCAGTACTTGCCCGTGCCGCTGGACAGCGCCTTCGA
GCCCGCCTTCCTCCGCAAGCGCAACGAGCGCGAGCGGCAGCGGGTGCGCTGCGTGAACGA
GGGCTATGCGCGCCTCCGAGACCACCTGCCCCGGGAGCTGGCAGACAAGCGCCTCAGCAA
AGTGGAGACGCTCCGCGCTGCCATCGACTACATCAAGCACCTGCAGGAGCTGCTGGAGCG
CCAGGCCTGGGGGCTCGAGGGCGCGGCCGGCGCCGTCCCCCAGCGCAGGGCGGAATGCAA
CAGCGACGGGGAGTCCAAGGCCTCTTCGGCGCCTTCGCCCAGCAGCGAGCCCGAGGAGGG
GGGCAGCTAGCGAGCGCCCGAACTGGCCAGGACCCCCGCGCCCGCCGCACAGCGCGCAGC
CGGGCGCTCAACCTAAGGTCCTCTTCGAAGGTGGTTTGCATTCTTAATCTGGCATCTTCT
CCAGGCCG
Restriction Sites Please inquire     
ACCN NM_203436
ORF Size 522 bp
Insert Size 700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_203436.2, NP_982260.2
RefSeq Size 2260
RefSeq ORF 522
Locus ID 121549
Gene Summary Basic helix-loop-helix transcription factors, such as ASCL4, are essential for the determination of cell fate and the development and differentiation of numerous tissues (Jonsson et al., 2004 [PubMed 15475265]). [supplied by OMIM, Mar 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.