ACYP1 (NM_203488) Human Untagged Clone

CAT#: SC308210

ACYP1 (untagged)-Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ACYP1
• Synonyms: ACYPE
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_203488, the custom clone sequence may differ by one or more nucleotides
  ATGGCAGAAGGAAACACCCTGATATCAGTGGATTATGAAATTTTTGGGAAGGTGCAAGGG
  GTGTTTTTCCGTAAGCATACTCAGGAAATGACTGTTGAAAACAGAATTGCTGAAACTCAC
  AGCAAGAGCTGTGTTCCAGTTAGCTTTGCTACCAGTTATGCAGGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_203488
• ORF Size: 168 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_203488.1, NP_982355.1
• RefSeq Size: 700
• RefSeq ORF: 168
• Locus ID: 97
• Protein Pathways: Pyruvate metabolism
• Gene Summary: This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (2) includes an alternate segment, compared to variant 1, that causes a frameshift. The resulting protein (isoform b) has a shorter and distinct C-terminus, compared to isoform a. Although the transcript is experimentally supported, the predicted protein encoded by this transcript needs to be experimentally verified.