IGSF1 (NM_205833) Human Untagged Clone

CAT#: SC308224

IGSF1 (untagged)-Human immunoglobulin superfamily, member 1 (IGSF1), transcript variant 2


  "NM_205833" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "IGSF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IGSF1
Synonyms CHTE; IGCD1; IGDC1; INHBP; p120; PGSF2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_205833, the custom clone sequence may differ by one or more nucleotides
ATGACCCTGGACAGACCAGGGGAGGGGGCCACCATGCTGAAGACATTCACTGTTTTGCTC
TTTTGCATTCGGATGAGTCTGGGTATGACATCGATAGTGATGGACCCTCAACCGGAGTTG
TGGATAGAGTCCAACTACCCCCAGGCCCCTTGGGAGAACATCACGCTTTGGTGCCGAAGC
CCCTCTCGGATATCAAGCAAGTTCCTGCTGCTGAAGGATAAGACACAGATGACCTGGATC
CGCCCTTCCCACAAGACCTTCCAAGTTTCATTCCTTATAGGTGCCCTTACTGAGTCCAAT
GCAGGTCTTTACCGGTGCTGCTACTGGAAGGAGACAGGCTGGTCAAAGCCCAGTAAAGTT
CTAGAGTTGGAGGCACCAGGCCAACTGCCCAAGCCCATCTTCTGGATTCAGGCTGAGACC
CCCGCTCTTCCTGGGTGTAATGTTAACATCCTCTGCCATGGCTGGCTGCAGGATTTGGTA
TTCATGCTGTTTAAAGAGGGATATGCAGAGCCTGTGGATTACCAAGTCCCAACTGGGACA
ATGGCCATATTCTCCATTGACAACCTGACACCTGAGGATGAAGGGGTTTACATCTGCCGC
ACTCATATCCAGATGCTCCCCACCCTGTGGTCAGAGCCCAGCAACCCCCTGAAGCTGGTT
GTAGCAGGTGGGTGTGGCTATGGCTGCTGGCATCTGGCAATTGTTGTCCCAGGTATCATG
GCTGGCTGA
Restriction Sites Please inquire     
ACCN NM_205833
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_205833.1, NP_991402.1
RefSeq Size 1813 bp
RefSeq ORF 729 bp
Locus ID 3547
Cytogenetics Xq26.1
Protein Families Transmembrane
Gene Summary 'This gene encodes a member of the immunoglobulin-like domain-containing superfamily. Proteins in this superfamily contain varying numbers of immunoglobulin-like domains and are thought to participate in the regulation of interactions between cells. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]'
Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 3. The resulting protein (isoform 2) has a distinct C-terminus and is shorter than isoform 3. Variants 2 and 5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.