SLC26A5 (NM_206885) Human Untagged Clone

CAT#: SC308297

SLC26A5 (untagged)-Human solute carrier family 26, member 5 (prestin) (SLC26A5), transcript variant d

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC26A5
• Synonyms: DFNB61; PRES
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_206885, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATCATGCTGAAGAAAATGAAATCCTTGCAGCAACCCAGAGGTACTATGTGGAAAGGCCTATCTTTA
  GTCATCCGGTCCTCCAGGAAAGACTACACACAAAGGACAAGGTTCCTGATTCCATTGCGGATAAGCTGAA
  ACAGGCATTCACATGTACTCCTAAAAAAATAAGAAATATCATTTATATGTTCCTACCCATAACTAAATGG
  CTGCCAGCATACAAATTCAAGGAATATGTGTTGGGTGACTTGGTCTCAGGCATAAGCACAGGGGTGCTTC
  AGCTTCCTCAAGGCTTAGCCTTTGCAATGCTGGCAGCTGTGCCTCCAATATTTGGCCTGTACTCTTCATT
  TTACCCTGTTATCATGTATTGTTTTCTTGGAACCTCCAGACACATATCCATAGGTCCTTTTGCTGTTATT
  AGCCTGATGATTGGTGGTGTAGCTGTTCGATTAGTACCAGATGATATAGTCATTCCAGGAGGAGTAAATG
  CAACCAATGGCACAGAGGCCAGAGATGCCTTGAGAGTGAAAGTCGCCATGTCTGTGACCTTACTTTCAGG
  AATCATTCAGTTTTGCCTAGGTGTCTGTAGGTTTGGATTTGTGGCCATATATCTCACAGAGCCTCTGGTC
  CGTGGGTTTACCACCGCAGCAGCTGTGCATGTCTTCACCTCCATGTTAAAATATCTGTTTGGAGTTAAAA
  CAAAGCGGTACAGTGGAATCTTTTCCGTGGTGTATAGTACAGTTGCTGTGTTGCAGAATGTTAAAAACCT
  CAACGTGTGTTCCCTAGGCGTCGGGCTGATGGTTTTTGGTTTGCTGTTGGGTGGCAAGGAGTTTAATGAG
  AGATTTAAAGAGAAATTGCCGGCGCCTATTCCTTTAGAGTTCTTTGCGGTCGTAATGGGAACTGGCATTT
  CAGCTGGGTTTAACTTGAAAGAATCATACAATGTGGATGTCGTTGGAACACTTCCTCTAGGCTTTCATAC
  AGAGATGACCAGAAGATGGAGACCGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_206885
• ORF Size: 1008 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_206885.2, NP_996768.1
• RefSeq Size: 1448
• RefSeq ORF: 1008
• Locus ID: 375611
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
  Transcript Variant: This variant (d), also known as SLC26A5d, lacks multiple exons within the coding region and uses an alternate 3' end-exon compared to variant a. The resulting isoform (d) has a distinct and shorter C-terminus, as compared to isoform a.