NOLA1 (GAR1) (NM_032993) Human Untagged Clone

CAT#: SC308737

GAR1 (untagged)-Human GAR1 ribonucleoprotein homolog (yeast) (GAR1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GAR1
• Synonyms: NOLA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032993, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTTTTCGAGGCGGAGGTCGTGGAGGCTTTAATCGAGGTGGTGGAGGTGGCGGCTTCAACCGAGGTG
  GCAGCAGCAACCACTTCCGAGGTGGAGGCGGCGGTGGAGGCGGCGGCAATTTCAGAGGCGGCGGCAGGGG
  AGGATTTGGACGAGGGGGTGGCCGCGGAGGCTTTAACAAAGGCCAAGACCAAGGACCTCCAGAACGTGTA
  GTCTTATTAGGAGAGTTCCTGCATCCCTGTGAAGATGACATAGTTTGTAAATGTACCACAGATGAAAATA
  AGGTGCCTTATTTCAATGCTCCTGTTTACTTAGAAAACAAAGAACAAATTGGAAAAGTGGATGAAATATT
  TGGACAACTCAGAGATTTTTATTTTTCAGTTAAGTTGTCAGAAAACATGAAGGCTTCATCCTTTAAAAAA
  CTACAGAAGTTTTATATAGACCCATATAAGCTGCTGCCACTGCAGAGGTTTTTACCTCGACCTCCAGGTG
  AGAAAGGACCTCCAAGAGGTGGTGGCAGGGGAGGCCGAGGAGGAGGAAGAGGAGGAGGTGGCAGAGGTGG
  TGGCAGAGGCGGTGGTTTTAGAGGTGGAAGAGGAGGTGGAGGTGGGGGCTTCAGAGGAGGAAGAGGTGGT
  GGTTTCAGAGGGAGAGGACATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_032993
• ORF Size: 654 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032993.2, NP_127460.1
• RefSeq Size: 1021
• RefSeq ORF: 654
• Locus ID: 54433
• Protein Families: Stem cell - Pluripotency
• Gene Summary: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA2 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. These four H/ACA snoRNP proteins are also components of the telomerase complex. The encoded protein of this gene contains two glycine- and arginine-rich domains and is related to Saccharomyces cerevisiae Gar1p. Two splice variants have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks a region of sequence in the 5' UTR when compared to variant 1. The encoded protein is identical for both transcript variants.