TBX5 (NM_080717) Human Untagged Clone

CAT#: SC309083

TBX5 (untagged)-Human T-box 5 (TBX5), transcript variant 3


  "NM_080717" in other vectors (4)

Reconstitution Protocol

USD 780.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TBX5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TBX5
Synonyms HOS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_080717, the custom clone sequence may differ by one or more nucleotides
ATGGAGGGAATCAAAGTGTTTCTCCATGAAAGAGAACTGTGGCTAAAATTCCACGAAGTG
GGCACGGAAATGATCATAACCAAGGCTGGAAGGCGGATGTTTCCCAGTTACAAAGTGAAG
GTGACGGGCCTTAATCCCAAAACGAAGTACATTCTTCTCATGGACATTGTACCTGCCGAC
GATCACAGATACAAATTCGCAGATAATAAATGGTCTGTGACGGGCAAAGCTGAGCCCGCC
ATGCCTGGCCGCCTGTACGTGCACCCAGACTCCCCCGCCACCGGGGCGCATTGGATGAGG
CAGCTCGTCTCCTTCCAGAAACTCAAGCTCACCAACAACCACCTGGACCCATTTGGGCAT
ATTATTCTAAATTCCATGCACAAATACCAGCCTAGATTACACATCGTGAAAGCGGATGAA
AATAATGGATTTGGCTCAAAAAATACAGCGTTCTGCACTCACGTCTTTCCTGAGACTGCG
TTTATAGCAGTGACTTCCTACCAGAACCACAAGATCACGCAATTAAAGATTGAGAATAAT
CCCTTTGCCAAAGGATTTCGGGGCAGTGATGACATGGAGCTGCACAGAATGTCAAGAATG
CAAAGTAAAGAATATCCCGTGGTCCCCAGGAGCACCGTGAGGCAAAAAGTGGCCTCCAAC
CACAGTCCTTTCAGCAGCGAGTCTCGAGCTCTCTCCACCTCATCCAATTTGGGGTCCCAA
TACCAGTGTGAGAATGGTGTTTCCGGCCCCTCCCAGGACCTCCTGCCTCCACCCAACCCA
TACCCACTGCCCCAGGAGCATAGCCAAATTTACCATTGTACCAAGAGGAAAGAGGAAGAA
TGTTCCACCACAGACCATCCCTATAAGAAGCCCTACATGGAGACATCACCCAGTGAAGAA
GATTCCTTCTACCGCTCTAGCTATCCACAGCAGCAGGGCCTGGGTGCCTCCTACAGGACA
GAGTCGGCACAGCGGCAAGCTTGCATGTATGCCAGCTCTGCGCCCCCCAGCGAGCCTGTG
CCCAGCCTAGAGGACATCAGCTGCAACACGTGGCCAAGCATGCCTTCCTACAGCAGCTGC
ACCGTCACCACCGTGCAGCCCATGGACAGGCTACCCTACCAGCACTTCTCCGCTCACTTC
ACCTCGGGGCCCCTGGTCCCTCGGCTGGCTGGCATGGCCAACCATGGCTCCCCACAGCTG
GGAGAGGGAATGTTCCAGCACCAGACCTCCGTGGCCCACCAGCCTGTGGTCAGGCAGTGT
GGGCCTCAGACTGGCCTGCAGTCCCCTGGCACCCTTCAGCCCCCTGAGTTCCTCTACTCT
CATGGCGTGCCAAGGACTCTATCCCCTCATCAGTACCACTCTGTGCACGGAGTTGGCATG
GTGCCAGAGTGGAGCGACAATAGCTAA
Restriction Sites Please inquire     
ACCN NM_080717
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_080717.2, NP_542448.1
RefSeq Size 3736 bp
RefSeq ORF 1407 bp
Locus ID 6910
Cytogenetics 12q24.21
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) lacks the exon containing the translation start site compared to transcript variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.