CSHL1 (NM_022581) Human Untagged Clone
CAT#: SC309486
CSHL1 (untagged)-Human chorionic somatomammotropin hormone-like 1 (CSHL1), transcript variant 2
"NM_022581" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CSHL1 |
Synonyms | CS-5; CSHP1; CSL; GHB4; hCS-L |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_022581, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGG CTTCAAGAGGCTGGTGCCGTCCAAACCGTTCCCTTATCCAGGCTTTTTAAAGAGGCTATG CTCCAAGCCCATCGCGCACACCAGCTGGCCATTGACACCTACCAGGAGTTTATAAGCTCT TGGGGAATGGACTCTATTCCGACATCCTCCAACATGGAGGAAACGCAGCAGAAATCCAAC TTAGAGCTGCTCCACATCTCCCTGCTGCTCATCGAGTCGCGGCTGGAGCCCGTGCGGTTC CTCAGGAGTACCTTCACCAACAACCTGGTGTATGACACCTCGGACAGCGATGACTATCAC CTCCTAAAGGACCTAGAGGAAGGCATCCAAATGCTGATGGGGAGGCTGGAAGACGGCAGC CACCTGACTGGGCAGACCCTCAAGCAGACCTACAGCAAGTTTGACACAAACTCGCACAAC CATGACGCACTGCTCAAGAACTACGGGCTGCTCCACTGCTTCAGGAAGGACATGGACAAG GTCGAGACATTCCTGCGCATGGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_022581 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022581.1, NP_072103.1 |
RefSeq Size | 768 bp |
RefSeq ORF | 600 bp |
Locus ID | 1444 |
Cytogenetics | 17q23.3 |
Protein Families | Secreted Protein |
Gene Summary | 'The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. This particular family member is expressed in placental villi, although it was originally thought to be a pseudogene. In fact, alternative splicing suggests that the majority of the transcripts would be unable to express a secreted protein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2), also known as CS-L(L), lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (2), that is missing an internal segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211759 | CSHL1 (Myc-DDK-tagged)-Human chorionic somatomammotropin hormone-like 1 (CSHL1), transcript variant 2 |
USD 420.00 |
|
RG211759 | CSHL1 (GFP-tagged) - Human chorionic somatomammotropin hormone-like 1 (CSHL1), transcript variant 2 |
USD 460.00 |
|
RC211759L3 | Lenti-ORF clone of CSHL1 (Myc-DDK-tagged)-Human chorionic somatomammotropin hormone-like 1 (CSHL1), transcript variant 2 |
USD 620.00 |
|
RC211759L4 | Lenti-ORF clone of CSHL1 (mGFP-tagged)-Human chorionic somatomammotropin hormone-like 1 (CSHL1), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review