PFKFB2 (NM_006212) Human Untagged Clone
CAT#: SC310311
PFKFB2 (untagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant 1
"NM_006212" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PFKFB2 |
Synonyms | PFK-2/FBPase-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_006212, the custom clone sequence may differ by one or more nucleotides
ATGTCTGGGGCATCTTCCTCAGAACAGAACAACAACAGCTATGAAACCAAAACCCCAAATCTTCGAATGT CAGAGAAGAAATGTTCATGGGCCTCCTACATGACCAACTCCCCGACTCTGATCGTTATGATTGGTTTGCC AGCCCGGGGTAAAACCTACGTGTCCAAGAAACTAACACGCTACCTCAACTGGATTGGAGTCCCCACCAAA GTGTTTAATCTTGGGGTGTATCGGCGTGAAGCAGTCAAGTCCTATAAGTCCTACGACTTCTTTCGGCATG ACAATGAGGAGGCCATGAAGATCCGCAAACAGTGTGCTCTGGTGGCGCTGGAAGATGTTAAGGCGTATCT CACTGAGGAGAATGGTCAGATTGCGGTGTTTGATGCCACCAATACAACCCGGGAGAGGAGGGACATGATT TTGAACTTTGCTGAACAGAATTCCTTCAAGGTATTCTTTGTGGAATCCGTCTGTGATGATCCTGATGTCA TTGCTGCCAATATTCTGGAGGTTAAGGTATCAAGCCCTGACTATCCTGAAAGGAACAGAGAGAACGTGAT GGAGGACTTCCTGAAGAGAATTGAATGCTACAAAGTTACCTACCGACCTCTTGACCCAGACAACTATGAC AAGGATCTTTCTTTCATCAAGGTGATAAACGTGGGCCAGCGATTTTTAGTCAACAGAGTCCAGGACTACA TCCAGAGCAAGATAGTCTACTACCTCATGAATATCCACGTCCAGCCTCGCACCATTTACCTTTGCCGGCA TGGAGAAAGCGAGTTCAATCTCTTGGGGAAGATTGGGGGTGACTCTGGCCTCTCGGTGCGGGGAAAGCAG TTTGCCCAAGCTCTAAGGAAATTTCTGGAGGAACAGGAAATAACAGACCTCAAAGTGTGGACAAGCCAGT TGAAGAGGACCATACAGACTGCTGAATCTCTCGGGGTGCCCTATGAGCAGTGGAAGATTCTGAATGAGAT TGATGCTGGTGTGTGTGAAGAGATGACCTATGCAGAGATTGAGAAACGGTACCCAGAAGAGTTTGCACTT CGAGATCAAGAGAAGTATCTGTATCGATATCCTGGTGGGGAGTCATACCAGGACCTGGTGCAGCGGCTGG AGCCTGTCATCATGGAGCTGGAACGTCAGGGCAATGTCCTCGTCATCTCCCACCAGGCTGTCATGCGCTG CCTCCTGGCCTACTTCTTGGATAAGGGCGCAGATGAGCTACCATACTTGAGATGCCCTCTCCATACCATC TTCAAACTTACTCCTGTGGCCTATGGGTGCAAAGTGGAAACAATTAAACTTAACGTGGAGGCTGTGAACA CGCACCGTGACAAGCCAACTAACAACTTCCCCAAGAACCAAACCCCTGTAAGGATGAGAAGGAACAGCTT TACGCCTCTGTCCAGTTCGAATACAATAAGGCGTCCAAGAAATTACAGTGTTGGGAGCCGGCCCCTCAAG CCCCTCAGCCCTCTCCGTGCCCAGGACATGCAAGAAGGGGCCGACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_006212 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006212.2, NP_006203.2 |
RefSeq Size | 7073 bp |
RefSeq ORF | 1518 bp |
Locus ID | 5208 |
Cytogenetics | 1q32.1 |
Domains | PGAM, 6PF2K |
Protein Families | Druggable Genome |
Protein Pathways | Fructose and mannose metabolism |
Gene Summary | 'The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211329 | PFKFB2 (Myc-DDK-tagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant 1 |
USD 480.00 |
|
RG211329 | PFKFB2 (GFP-tagged) - Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant 1 |
USD 530.00 |
|
RC211329L1 | Lenti ORF clone of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant 1, Myc-DDK-tagged |
USD 680.00 |
|
RC211329L2 | Lenti ORF clone of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant 1, mGFP tagged |
USD 680.00 |
|
RC211329L3 | Lenti ORF clone of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant 1, Myc-DDK-tagged |
USD 680.00 |
|
RC211329L4 | Lenti ORF clone of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant 1, mGFP tagged |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review