SETD7 (NM_030648) Human Untagged Clone

CAT#: SC310486

SETD7 (untagged)-Human SET domain containing (lysine methyltransferase) 7 (SETD7)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SETD7
• Synonyms: KMT7; SET7; SET7/9; SET9
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_030648, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATAGCGACGACGAGATGGTGGAGGAGGCGGTGGAAGGGCACCTGGACGATGACGGATTACCGCACG
  GGTTCTGCACAGTCACCTACTCCTCCACAGACAGATTTGAGGGGAACTTTGTTCACGGAGAAAAGAACGG
  ACGGGGGAAGTTCTTCTTCTTTGATGGCAGCACCCTGGAGGGGTATTATGTGGATGATGCCTTGCAGGGC
  CAGGGAGTTTACACTTACGAAGATGGGGGAGTTCTCCAGGGCACGTATGTAGACGGAGAGCTGAACGGTC
  CAGCCCAGGAATATGACACAGATGGGAGACTGATCTTCAAGGGGCAGTATAAAGATAACATTCGTCATGG
  AGTGTGCTGGATATATTACCCAGATGGAGGAAGCCTTGTAGGAGAAGTAAATGAAGATGGGGAGATGACT
  GGAGAGAAGATAGCCTATGTGTACCCTGATGAGAGGACCGCACTTTATGGGAAATTTATTGATGGAGAGA
  TGATAGAAGGCAAACTGGCTACCCTTATGTCCACTGAAGAAGGGAGGCCTCACTTTGAACTGATGCCTGG
  AAATTCAGTGTACCACTTTGATAAGTCGACTTCATCTTGCATTTCTACCAATGCTCTTCTTCCAGATCCT
  TATGAATCAGAAAGGGTTTATGTTGCTGAATCTCTTATTTCCAGTGCTGGAGAAGGACTTTTTTCAAAGG
  TAGCTGTGGGACCTAATACTGTTATGTCTTTTTATAATGGAGTTCGAATTACACACCAAGAGGTTGACAG
  CAGGGACTGGGCCCTTAATGGGAACACCCTCTCCCTTGATGAAGAAACGGTCATTGATGTGCCTGAGCCC
  TATAACCACGTATCCAAGTACTGTGCCTCCTTGGGACACAAGGCAAATCACTCCTTCACTCCAAACTGCA
  TCTACGATATGTTTGTCCACCCCCGTTTTGGGCCCATCAAATGCATCCGCACCCTGAGAGCAGTGGAGGC
  CGATGAAGAGCTCACCGTTGCCTATGGCTATGACCACAGCCCCCCCGGGAAGAGTGGGCCTGAAGCCCCT
  GAGTGGTACCAGGTGGAGCTGAAGGCCTTCCAGGCCACCCAGCAAAAGTGA
  
  
• Restriction Sites: NotI-NotI
• ACCN: NM_030648
• ORF Size: 1101 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.

Reference Data

• RefSeq: NM_030648.2, NP_085151.1
• RefSeq Size: 7012
• RefSeq ORF: 1101
• Locus ID: 80854
• Domains: SET, MORN
• Protein Families: Druggable Genome
• Protein Pathways: Lysine degradation
• Gene Summary: Histone methyltransferase that specifically monomethylates 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. Plays a central role in the transcriptional activation of genes such as collagenase or insulin. Recruited by IPF1/PDX-1 to the insulin promoter, leading to activate transcription. Has also methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding the [KR]-[STA]-K in substrate proteins. Monomethylates 'Lys-189' of TAF10, leading to increase the affinity of TAF10 for RNA polymerase II. Monomethylates 'Lys-372' of p53/TP53, stabilizing p53/TP53 and increasing p53/TP53-mediated transcriptional activation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.