MEF2B (BORCS8-MEF2B) (NM_005919) Human Untagged Clone

CAT#: SC310487

MEF2BNB (untagged)-Human MEF2BNB-MEF2B readthrough (MEF2BNB-MEF2B), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BORCS8-MEF2B
• Synonyms: LOC729991-MEF2B; MEF2B; MEF2BNB-MEF2B; RSRFR2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_005919 edited
  CATCAGCATCCGGGACCATATGAATGCCAGTGCCCAGGGCCACAGCCCGGAGGAACCACC
  CCCGCCCTCCTCAGCCTGATCCTGGAAGAGACTCGGGGCCCCCCAGCCTCCGCCAACCCA
  GACAAAGATCATTCCACTCAGCCTGGGACGATGGGGAGGAAAAAAATCCAGATCTCCCGC
  ATCCTGGACCAAAGGAATCGGCAGGTGACGTTCACCAAGCGGAAGTTCGGGCTGATGAAG
  AAGGCCTATGAGCTGAGCGTGCTCTGTGACTGTGAGATAGCCCTCATCATCTTCAACAGC
  GCCAACCGCCTCTTCCAGTATGCCAGCACGGACATGGACCGTGTGCTGCTGAAGTACACA
  GAGTACAGCGAGCCCCACGAGAGCCGCACCAACACTGACATCCTCGAGACGCTGAAGCGG
  AGGGGCATTGGCCTCGATGGGCCAGAGCTGGAGCCGGATGAAGGGCCTGAGGAGCCAGGA
  GAGAAGTTTCGGAGGCTGGCAGGCGAAGGGGGTGATCCGGCCTTGCCCCGACCCCGGCTG
  TATCCTGCAGCTCCTGCTATGCCCAGCCCAGATGTGGTATACGGGGCCTTACCGCCACCA
  GGCTGTGACCCCAGTGGGCTTGGGGAAGCACTGCCCGCCCAGAGCCGCCCATCTCCCTTC
  CGACCAGCAGCCCCCAAAGCCGGGCCCCCAGGCCTGGTGCACCCTCTCTTCTCACCAAGC
  CACCTCACCAGCAAGACACCACCCCCACTGTACCTGCCGACGGAAGGGCGGAGGTCAGAC
  CTGCCTGGTGGCCTGGCTGGGCCCCGAGGGGGACTAAACACCTCCAGAAGCCTCTACAGT
  GGCCTGCAGAACCCCTGCTCCACTGCAACTCCCGGACCCCCACTGGGGAGCTTCCCCTTC
  CTCCCCGGAGGCCCCCCAGTGGGGGCCGAAGCCTGGGCGAGGAGGGTCCCCCAACCCGCG
  GCGCCTCCCCGCCGACCCCCCCAGTCAGCATCAAGTCTGAGCGCCTCTCTCCGGCCCCCG
  GGGGCCCCGGCGACTTTCCTAAGACCTTCCCCTATCCCTTGCTCCTCGCCCGGTCCCTGG
  CAGAGCCTCTGCGGCCTGGGCCCGCCCTGCGCCGGCTGCCCTTGGCCGACGGCTGGCCCC
  GGTAGGAGATCACCCGGTGGCACCAGCCCAGAGCGCTCGCCAGGTACGGCGAGGGCACGT
  GGGGACCCCACCTCCCTCCAGGCCTCTTCAGAGAAGACCCAACAGTGACGCCCCCCTCCG
  CGGTGGGGGCTTGGAGGTGGGCGGCTGGACTCAATCCACCCTGGGGGGCTCCTTTCCTTC
  TTCCTATTTGTGTGTATATCCACAAATAAAACGCGCGT
  
• Restriction Sites: Please inquire
• ACCN: NM_005919
• Insert Size: 1300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005919.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005919.1, NP_005910.1
• RefSeq Size: 1671 bp
• RefSeq ORF: 1098 bp
• Locus ID: 4207
• Cytogenetics: 19p13.11
• Domains: MADS
• Protein Families: Transcription Factors
• Gene Summary: 'This gene represents numerous read-through transcripts that span GeneID:729991 and 100271849. Many read-through transcripts are predicted to be nonsense-mediated decay (NMD) candidates, and are thought to be non-coding. Some transcripts are predicted to be capable of translation reinitiation at a downstream AUG, resulting in expression of at least one isoform of myocyte enhancer factor 2B (MEF2B) from this read-through locus. At least one additional MEF2B variant and isoform can be expressed from a downstream promoter, and is annotated on GeneID:100271849. [provided by RefSeq, Oct 2010]'
  Transcript Variant: This variant (1) lacks two alternate exons in the 5' region and one alternate exon in the 3' region, compared to variant 2. This variant is thought to be protein coding because translation can reinitiate at the downstream AUG, resulting in expression of an isoform of MEF2B (geneID:100271849). Isoform b has a shorter and distinct C-terminus, compared to MEF2A isoform a (NP_001139257.1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.