RNF14 (NM_183398) Human Untagged Clone

CAT#: SC310517

RNF14 (untagged)-Human ring finger protein 14 (RNF14), transcript variant 2


  "NM_183398" in other vectors (4)

Reconstitution Protocol

SC310517 is the updated version of SC127138.

USD 760.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNF14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNF14
Synonyms ARA54; HFB30; HRIHFB2038; TRIAD2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_183398, the custom clone sequence may differ by one or more nucleotides
ATGCAATTTCTTAAGGAAGAGACCCTAGCATACTTGAATATTGTCTCTCCTTTTGAGCTC
AAGATTGGTTCTCAGAAAAAAGTGCAGAGAAGGACAGCTCAAGCTTCTCCCAACACAGAG
CTAGATTTTGGAGGAGCTGCTGGATCTGATGTAGACCAAGAGGAAATTGTGGATGAGAGA
GCAGTGCAGGATGTGGAATCACTGTCAAATCTGATCCAGGAAATCTTGGACTTTGATCAA
GCTCAGCAGATAAAATGCTTTAATAGTAAATTGTTCCTGTGCAGTATCTGTTTCTGTGAG
AAGCTGGGTAGTGAATGCATGTACTTCTTGGAGTGCAGGCATGTGTACTGCAAAGCCTGT
CTGAAGGACTACTTTGAAATCCAGATCAGAGATGGCCAGGTTCAATGCCTCAACTGCCCA
GAACCAAAGTGCCCTTCGGTGGCCACTCCTGGTCAGGTCAAAGAGTTAGTGGAAGCAGAG
TTATTTGCCCGTTATGACCGCCTTCTCCTCCAGTCCTCCTTGGACCTGATGGCAGATGTG
GTGTACTGCCCCCGGCCGTGCTGCCAGCTGCCTGTGATGCAGGAACCTGGCTGCACCATG
GGTATCTGCTCCAGCTGCAATTTTGCCTTCTGTACTTTGTGCAGGTTGACCTACCATGGG
GTCTCCCCATGTAAGGTGACTGCAGAGAAATTAATGGACTTACGAAATGAATACCTGCAA
GCGGATGAGGCTAATAAAAGACTTTTGGATCAAAGGTATGGTAAGAGAGTGATTCAGAAG
GCACTGGAAGAGATGGAAAGTAAGGAGTGGCTAGAGAAGAACTCAAAGAGCTGCCCATGT
TGTGGAACTCCCATAGAGAAATTAGACGGATGTAACAAGATGACATGTACTGGCTGTATG
CAATATTTCTGTTGGATTTGCATGGGTTCTCTCTCTAGAGCAAACCCTTACAAACATTTC
AATGACCCTGGTTCACCATGTTTTAACCGGCTGTTTTATGCTGTGGATGTTGACGACGAT
ATTTGGGAAGATGAGGTAGAAGACTAG
Restriction Sites Please inquire     
ACCN NM_183398
ORF Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_183398.1, NP_899645.1
RefSeq Size 2992
RefSeq ORF 1047
Locus ID 9604
Protein Families Druggable Genome, Transcription Factors
Gene Summary The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein interacts with androgen receptor (AR) and may function as a coactivator that induces AR target gene expression in prostate. A dominant negative mutant of this gene has been demonstrated to inhibit the AR-mediated growth of prostate cancer. This protein also interacts with class III ubiquitin-conjugating enzymes (E2s) and may act as a ubiquitin-ligase (E3) in the ubiquitination of certain nuclear proteins. Six alternatively spliced transcript variants encoding two distinct isoforms have been reported. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) lacks an exon compared to variant 1. The translation begins at a downstream start codon and results in an isoform (2) that has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.