SSX4 (SSX4B) (NM_001040612) Human Untagged Clone

CAT#: SC311197

SSX4B (untagged)-Human synovial sarcoma, X breakpoint 4B (SSX4B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SSX4B
• Synonyms: CT5.4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040612, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACGGAGACGACGCCTTTGCAAGGAGACCCAGGGATGATGCTCAAATATCAGAGAAGTTACGAAAGG
  CCTTCGATGATATTGCCAAATACTTCTCTAAGAAAGAGTGGGAAAAGATGAAATCCTCGGAGAAAATCGT
  CTATGTGTATATGAAGCTAAACTATGAGGTCATGACTAAACTAGGTTTCAAGGTCACCCTCCCACCTTTC
  ATGCGTAGTAAACGGGCTGCAGACTTCCACGGGAATGATTTTGGTAACGATCGAAACCACAGGAATCAGG
  TTGAACGTCCTCAGATGACTTTCGGCAGCCTCCAGAGAATCTTCCCGAAGGACCCAAAAGGGGGAAACAT
  GCCTGGACCCACAGACTGCGTGAGAGAAAGCAGCTGGTGGTTTATGAAGAGATCAGCGACCCTGAGGAAG
  ATGACGAGTAACTCCCCTCGGGGATATGACACATGCCCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001040612
• ORF Size: 462 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040612.2, NP_001035702.1
• RefSeq Size: 1108
• RefSeq ORF: 462
• Locus ID: 548313
• Gene Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. This gene, SSX4B, represents the more centromeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an exon in the 3' coding region compared to variant 1. This results in a frame-shift, and a shorter isoform (b) with a distinct C-terminus compared to isoform a. CCDS Note: SSXB4 is identical to SSX4 as it produces the same protein product. This protein is likey to be functional despite arising from a duplication, therefore this CCDS has been retained. COMPLETENESS: complete on the 3' end.