ATF3 (NM_001040619) Human Untagged Clone

CAT#: SC311198

ATF3 (untagged)-Human activating transcription factor 3 (ATF3), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATF3
• Synonyms: FLJ41705
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040619, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGCTTCAACACCCAGGCCAGGTCTCTGCCTCGGAAGTGAGTGCTTCTGCCATCGTCCCCTGCCTGT
  CCCCTCCTGGGTCACTGGTGTTTGAGGATTTTGCTAACCTGACGCCCTTTGTCAAGGAAGAGCTGAGGTT
  TGCCATCCAGAACAAGCACCTCTGCCACCGGATGTCCTCTGCGCTGGAATCAGTCACTGTCAGCGACAGA
  CCCCTCGGGGTGTCCATCACAAAAGCCGAGGTAGCCCCTGAAGAAGATGAAAGGAAAAAGAGGCGACGAG
  AAAGAAATAAGATTGCAGCTGCAAAGTGCCGAAACAAGAAGAAGGAGAAGACGGAGTGCCTGCAGAAACT
  CCCAAGGCCCTTTTGGGTCCAGAAGACCTGCATATGGGCTGTTGACTCATGCAAATGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_001040619
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001040619.1, NP_001035709.1
• RefSeq Size: 2361 bp
• RefSeq ORF: 408 bp
• Locus ID: 467
• Cytogenetics: 1q32.3
• Protein Families: Transcription Factors
• Gene Summary: 'This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011]'
  Transcript Variant: This variant (4, also known as deltaZip2a) contains an alternate terminal exon, and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2, also known as deltaZip2) has a distinct and shorter C-terminus, compared to isoform 1. Isoform 2 lacks the leucine zipper protein-dimerization motif and does not bind to DNA, and it stimulates transcription presumably by sequestering inhibitory co-factors away from the promoter.