PTPN20A (NM_001042392) Human Untagged Clone

CAT#: SC311238

PTPN20A (untagged)-Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PTPN20A
• Synonyms: bA142I17.1; CT126; hPTPN20; PTPN20B
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001042392, the custom clone sequence may differ by one or more nucleotides
  ATGATTGATGATTCAACACGCGTTCCTCTTGGAAAAAGCAAGGACTACATCAATGCTAGT
  TATATTAGAATAGTCAATTGTGGAGAAGAGTATTTTTATATCGCTACTCAAGGACCACTG
  CTGAGCACCATAGATGACTTTTGGCAAATGGTGTTGGAAAATAATTCAAATGTTATTGCC
  ATGATAACCAGAGAGATAGAAGGTGGAATTATCAAATGCTACCATTACTGGCCCATTTCT
  CTGAAGAAGCCATTGGAATTGAAACACTTCCGTGTATTCCTGGAGAACTACCAGATACTT
  CAATATTTCATCATTCGAATGTTTCAAGTTGTGGAGAAGTCCACGGGAACTAGTCACTCT
  GTAAAACAGTTGCAGTTCACCAAGTGGCCAGACCATGGCACTCCTGCCTCAGCAGATAGC
  TTCATAAAATATATTCGTTATGCAAGGAAGAGCCACCTTACAGGACCCATGGTTGTTCAC
  TGCAGTGCCGGCATAGGCCGGACAGGGGTGTTCCTATGTGTGGATGTCGTGTTCTGTGCC
  ATCGTAAAGAACTGTTCATTCAACATCATGGATATAGTGGCCCAAATGAGAGAACAACGT
  TCTGGCATGGTTCAAACGAAGGAGCAGTATCACTTTTGTTACGATATTGTGCTTGAAGTT
  CTTCGGAAACTTCTGACTTTGGATTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001042392
• ORF Size: 687 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001042392.1, NP_001035851.1
• RefSeq Size: 2321
• RefSeq ORF: 687
• Locus ID: 653129
• Protein Families: Druggable Genome
• Gene Summary: The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes and several are mutated in human diseases. Chromosome 10q contains a segmental duplication resulting in multiple copies of the protein tyrosine phosphatase, non-receptor type 20 gene. The two nearly identical copies are designated as PTPN20A and PTPN20B. A third copy is only partially duplicated and contains a pseudogene, designated as PTPN20C. This gene encodes the more centromeric copy, PTPN20A. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (5) differs in the 5' UTR and in the 5' coding region, compared to variant 1. The resulting protein (isoform 5) contains a distinct N-terminus, compared to isoform 1.