MYF5 (NM_005593) Human Untagged Clone

CAT#: SC311244

MYF5 (untagged)-Human myogenic factor 5 (MYF5)


  "NM_005593" in other vectors (6)

Reconstitution Protocol

SC311244 is the updated version of SC116681.

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MYF5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MYF5
Synonyms bHLHc2; EORVA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC311244 sequence for NM_005593 edited (data generated by NextGen Sequencing)
ATGGACGTGATGGATGGCTGCCAGTTCTCACCTTCTGAGTACTTCTACGACGGCTCCTGC
ATACCGTCCCCCGAGGGTGAATTTGGGGACGAGTTTGTGCCGCGAGTGGCTGCCTTCGGA
GCGCACAAAGCAGAGCTGCAGGGCTCAGATGAGGACGAGCACGTGCGAGCGCCTACCGGC
CACCACCAGGCTGGTCACTGCCTCATGTGGGCCTGCAAAGCCTGCAAGAGGAAGTCCACC
ACCATGGATCGGCGGAAGGCAGCCACTATGCGCGAGCGGAGGCGCCTGAAGAAGGTCAAC
CAGGCTTTCGAAACCCTCAAGAGGTGTACCACGACCAACCCCAACCAGAGGCTGCCCAAG
GTGGAGATCCTCAGGAATGCCATCCGCTACATCGAGAGCCTGCAGGAGTTGCTGAGAGAG
CAGGTGGAGAACTACTATAGCCTGCCGGGACAGAGCTGCTCGGAGCCCACCAGCCCCACC
TCCAACTGCTCTGATGGCATGCCCGAATGTAACAGTCCTGTCTGGTCCAGAAAGAGCAGT
ACTTTTGACAGCATCTACTGTCCTGATGTATCAAATGTATATGCCACAGATAAAAACTCC
TTATCCAGCTTGGATTGCTTATCCAACATAGTGGACCGGATCACCTCCTCAGAGCAACCT
GGGTTGCCTCTCCAGGATCTGGCTTCTCTCTCTCCAGTTGCCAGCACCGATTCACAGCCT
GCAACTCCAGGGGCTTCTAGTTCCAGGCTTATCTATCATGTGCTATGA

Clone variation with respect to NM_005593.2
Restriction Sites Please inquire     
ACCN NM_005593
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005593.1, NP_005584.1
RefSeq Size 1427 bp
RefSeq ORF 768 bp
Locus ID 4617
Cytogenetics 12q21.31
Domains HLH, Basic
Protein Families Druggable Genome, Transcription Factors
Gene Summary ''

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.