FBXO4 (NM_033484) Human Untagged Clone

CAT#: SC311466

FBXO4 (untagged)-Human F-box protein 4 (FBXO4), transcript variant 2


  "NM_033484" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FBXO4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FBXO4
Synonyms FBX4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_033484, the custom clone sequence may differ by one or more nucleotides


ATGGCGGGAAGCGAGCCGCGCAGCGGAACAAACTCGCCGCCGCCGCCCTTCAGCGACTGGGGCCGCCTGG
AGGCGGCCATCCTCAGCGGCTGGAAGACCTTCTGGCAGTCAGTGAGCAAGGAGAGGGTGGCGCGTACGAC
CTCACGGGAGGAGGTGGATGAGGCGGCCAGCACCCTGACGCGGCTGCCGATTGATGTACAGCTATATATT
TTGTCCTTTCTTTCACCTCATGATCTGTGTCAGTTGGGAAGTACAAATCATTATTGGAATGAAACTGTAA
GAGATCCAATTCTGTGGAGATACTTTTTGTTGAGGGATCTTCCTTCTTGGTCTTCTGTTGACTGGAAGTC
TCTTCCAGATCTAGAAATCTTAAAAAAGCCTATATCTGAGGTCACTGATGGTGCATTTTTTGACTACATG
GCAGTCTATAGAATGTGCTGTCCATACACAAGAAGAGCTTCAAAATCCAGCCGTCCTATGTATGGAGCTG
TCACTTCTTTTTTACACTCCCTGATCATTCAGAATGAACCACGATTTGCTATGTTTGGACCAGGTTTGGA
AGAATTGAATACCTCTTTGGTGTTGAGCTTGATGTCTTCAGAGGAACTTTGCCCAACAGCTGGTTTGCCT
CAGAGGCAGATTGATGGTATTGGATCAGGAGTCAATTTTCAGTTGAACAACCAACATAAATTCAACATTC
TAATCTTATATTCAACTACCAGAAAGGAAAGAGATAGAGCAAGGGAAGAGCATACAAGTGCAGTTAACAA
GATGTTCAGTCGACACAATGAAGGTGATGATCAACAAGGAAGCCGGTACAGTGTGATTCCACAGATTCAA
AAAGTGTGTGAAGTTGTAGATGGGTTCATCTATGTTGCAAATGCTGAAGCTCATAAAAGTAAGTACTCAT
ATGTACATTTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_033484
ORF Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_033484.2, NP_277019.1
RefSeq Size 1745
RefSeq ORF 924
Locus ID 26272
Domains F-box
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) lacks two exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.