Ribonuclease T2 (RNASET2) (AK001769) Human Untagged Clone

CAT#: SC311931

(untagged)-Human cDNA FLJ10907 fis, clone OVARC1000060

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNASET2
• Synonyms: RNASE6PL|bA514O12.3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK001769, the custom clone sequence may differ by one or more nucleotides
  ATGAGTGGGAAAAGCATGGGACCTGCGCCGCCCAGGTGGATGCGCTCAACTCCCAGAAGA
  AGTACTTTGGCAGAAGCCTGGAACTCTACAGGGAGCTGGACCTCAACAGGTGGGTGCGCC
  CTTCCCCCGGCTGCACTTCCCAGTGGGGATCTCTGCTGTCGCCCAAGCCTGACAGCTGGA
  TCCAGGGGAGTGGGTGTAGACCTCACTGCCCTCCAGCAGCTTCTGCATGTGCACTATTCG
  ACTACTGGGATCATTCCTGAGGAATGTTCTGAGCCTACCAAGCCTTTCCAGATCATTCTA
  CATCACGATCACACAGAGTGGGTGCAGAGTATTGGGATGCCCATCTGGGCACCATCTCAT
  CATCAGAGTCGGCCA
  
• Restriction Sites: Please inquire
• ACCN: AK001769
• ORF Size: 2445 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK001769.1
• RefSeq Size: 2445
• RefSeq ORF: 2445
• Locus ID: 8635
• Protein Families: Secreted Protein
• Gene Summary: This ribonuclease gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. [provided by RefSeq, Jul 2008]