IL28 Receptor alpha (IFNLR1) (AK098257) Human Untagged Clone
Product Images
Other products for "IFNLR1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IFNLR1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK098257, the custom clone sequence may differ by one or more nucleotides
ATGCTTTCAAGAGAGCATCAGCTGATACAACCTAAGGTCGCCTGGATAAGTATTTGGGTT TCTCAGGCCATAGGCAGTGCCATAGAGCTCCTAAGAGATTATGTCTTTTGTCTGAATTCA GAGTTTTTGTTTTTTGGCTGTCTCATGGAGTTTGCAGTGGCAAGCCACTTCCTTCAAAGA TTCTGTGAAATCTTGTGGCTTTCCTGCTGTGTTCCTGTGGTGGTTTTTGGAGCTAAAGTT CACGATGTGAGTTTCTACATGCTGTTCTGTCCTTCTGAGTGGGAGCTGCAAGTTAGTCCT GCCTCCTCACCACCATTTTTCCCTATTTTCAGTTTTTTGATGCTACCACAGTTTTATACC ACTTTGTTCTCAATCCCTCAGTCTCATCCTGCAGAAGCCCTTGCCTCCAACTCTATGGAG AAGAAT |
Restriction Sites | Please inquire |
ACCN | AK098257 |
ORF Size | 2066 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | AK098257.1 |
RefSeq Size | 2066 |
RefSeq ORF | 2066 |
Locus ID | 163702 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.