LAIR1 (NM_021706) Human Untagged Clone

CAT#: SC312732

LAIR1 (untagged)-Human leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), transcript variant b


  "NM_021706" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LAIR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LAIR1
Synonyms CD305; LAIR-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021706, the custom clone sequence may differ by one or more nucleotides


ATGTCTCCCCACCCCACCGCCCTCCTGGGCCTAGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGG
AAGATCTGCCCAGACCCTCCATCTCGGCTGAGCCAGGCACCGTGATCCCCCTGGGGAGCCATGTGACTTT
CGTGTGCCGGGGCCCGGTTGGGGTTCAAACATTCCGCCTGGAGAGGGACAGTAGATCCACATACAATGAT
ACTGAAGATGTGTCTCAAGCTAGTCCATCTGAGTCAGAGGCCAGATTCCGCATTGACTCAGTAAGAGAAG
GAAATGCCGGGCTTTATCGCTGCATCTATTATAAGCCCCCTAAATGGTCTGAGCAGAGTGACTACCTGGA
GCTGCTGGTGAAAGGACCCACGCAGAGGCCGTCGGACAACAGTCACAATGAGCATGCACCTGCTTCCCAA
GGCCTGAAAGCTGAGCATCTGTATATTCTCATCGGGGTCTCAGTGGTCTTCCTCTTCTGTCTCCTCCTCC
TGGTCCTCTTCTGCCTCCATCGCCAGAATCAGATAAAGCAGGGGCCCCCCAGAAGCAAGGACGAGGAGCA
GAAGCCACAGCAGAGGCCTGACCTGGCTGTTGATGTTCTAGAGAGGACAGCAGACAAGGCCACAGTCAAT
GGACTTCCTGAGAAGGACAGAGAGACGGACACCTCGGCCCTGGCTGCAGGGAGTTCCCAGGAGGTGACGT
ATGCTCAGCTGGACCACTGGGCCCTCACACAGAGGACAGCCCGGGCTGTGTCCCCACAGTCCACAAAGCC
CATGGCCGAGTCCATCACGTATGCAGCCGTTGCCAGACACTGA


Restriction Sites SgfI-MluI     
ACCN NM_021706
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021706.4, NP_068352.2
RefSeq Size 2767 bp
RefSeq ORF 813 bp
Locus ID 3903
Cytogenetics 19q13.42
Protein Families Transmembrane
Gene Summary 'The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
Transcript Variant: This variant (b) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (b) is shorter, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.