LAIR1 (NM_021706) Human Untagged Clone

CAT#: SC312732

LAIR1 (untagged)-Human leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), transcript variant b

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LAIR1
• Synonyms: CD305; LAIR-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_021706, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTCCCCACCCCACCGCCCTCCTGGGCCTAGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGG
  AAGATCTGCCCAGACCCTCCATCTCGGCTGAGCCAGGCACCGTGATCCCCCTGGGGAGCCATGTGACTTT
  CGTGTGCCGGGGCCCGGTTGGGGTTCAAACATTCCGCCTGGAGAGGGACAGTAGATCCACATACAATGAT
  ACTGAAGATGTGTCTCAAGCTAGTCCATCTGAGTCAGAGGCCAGATTCCGCATTGACTCAGTAAGAGAAG
  GAAATGCCGGGCTTTATCGCTGCATCTATTATAAGCCCCCTAAATGGTCTGAGCAGAGTGACTACCTGGA
  GCTGCTGGTGAAAGGACCCACGCAGAGGCCGTCGGACAACAGTCACAATGAGCATGCACCTGCTTCCCAA
  GGCCTGAAAGCTGAGCATCTGTATATTCTCATCGGGGTCTCAGTGGTCTTCCTCTTCTGTCTCCTCCTCC
  TGGTCCTCTTCTGCCTCCATCGCCAGAATCAGATAAAGCAGGGGCCCCCCAGAAGCAAGGACGAGGAGCA
  GAAGCCACAGCAGAGGCCTGACCTGGCTGTTGATGTTCTAGAGAGGACAGCAGACAAGGCCACAGTCAAT
  GGACTTCCTGAGAAGGACAGAGAGACGGACACCTCGGCCCTGGCTGCAGGGAGTTCCCAGGAGGTGACGT
  ATGCTCAGCTGGACCACTGGGCCCTCACACAGAGGACAGCCCGGGCTGTGTCCCCACAGTCCACAAAGCC
  CATGGCCGAGTCCATCACGTATGCAGCCGTTGCCAGACACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_021706
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021706.4, NP_068352.2
• RefSeq Size: 2767 bp
• RefSeq ORF: 813 bp
• Locus ID: 3903
• Cytogenetics: 19q13.42
• Protein Families: Transmembrane
• Gene Summary: 'The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
  Transcript Variant: This variant (b) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (b) is shorter, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.