WSB1 (NM_134265) Human Untagged Clone
CAT#: SC312769
WSB1 (untagged)-Human WD repeat and SOCS box containing 1 (WSB1), transcript variant 2
"NM_134265" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | WSB1 |
Synonyms | SWIP1; WSB-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_134265, the custom clone sequence may differ by one or more nucleotides
ATGGCCAGCTTTCCCCCGAGGGTCAACGAGAAAGAGATCGGAAAACTCCTCCTTAACTTGGTAGATCATA CTGAAGTGGTCAGAGATTTAACTTTTGCTCCAGATGGAAGCTTGATCCTGGTGTCAGCTTCAAGAGACAA AACTCTCAGAGTATGGGACCTGAAAGATGATGGAAACATGATGAAAGTATTGAGGGGGCATCAGAATTGG GTGTACAGCTGTGCATTCTCTCCTGACTCTTCTATGCTGTGTTCAGTCGGAGCCAGTAAAGCAGTTTTCC TTTGGAATATGGATAAATACACCATGATACGGAAACTAGAAGGACATCACCATGATGTGGTAGCTTGTGA CTTTTCTCCTGATGGAGCATTACTGGCTACTGCATCTTATGATACTCGAGTATATATCTGGGATCCACAT AATGGAGACATTCTGATGGAATTTGGGCACCTGTTTCCCCCACCTACTCCAATATTTGCTGGAGGAGCAA ATGACCGGTGGGTACGATCTGTATCTTTTAGCCATGATGGACTGCATGTTGCAAGCCTTGCTGATGATAA AATGGTGAGGTTCTGGAGAATTGATGAGGATTATCCAGTGCAAGTTGCACCTTTGAGCAATGGTCTTTGC TGTGCCTTCTCTACTGATGGCAGTGTTTTAGCTGCTGGGACACATGACGGAAGTGTGTATTTTTGGGCCA CTCCACGGCAGGTCCCTAGCCTGCAACATTTATGTCGCATGTCAATCCGAAGAGTGATGCCCACCCAAGA AGTTCAGGAGCTGCCGATTCCTTCCAAGCTTTTGGAGTTTCTCTCGTATCGTATTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_134265 |
ORF Size | 828 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_134265.2, NP_599027.1 |
RefSeq Size | 2411 |
RefSeq ORF | 828 |
Locus ID | 26118 |
Domains | SOCS, WD40 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the WD-protein subfamily. This protein shares a high sequence identity to mouse and chick proteins. It contains several WD-repeats spanning most of the protein and an SOCS box in the C-terminus. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks two in-frame exons in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217268 | WSB1 (Myc-DDK-tagged)-Human WD repeat and SOCS box containing 1 (WSB1), transcript variant 2 |
USD 420.00 |
|
RG217268 | WSB1 (GFP-tagged) - Human WD repeat and SOCS box containing 1 (WSB1), transcript variant 2 |
USD 460.00 |
|
RC217268L3 | Lenti ORF clone of Human WD repeat and SOCS box containing 1 (WSB1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC217268L4 | Lenti ORF clone of Human WD repeat and SOCS box containing 1 (WSB1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review