WSB1 (NM_134265) Human Untagged Clone

CAT#: SC312769

WSB1 (untagged)-Human WD repeat and SOCS box containing 1 (WSB1), transcript variant 2


  "NM_134265" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "WSB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WSB1
Synonyms SWIP1; WSB-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_134265, the custom clone sequence may differ by one or more nucleotides


ATGGCCAGCTTTCCCCCGAGGGTCAACGAGAAAGAGATCGGAAAACTCCTCCTTAACTTGGTAGATCATA
CTGAAGTGGTCAGAGATTTAACTTTTGCTCCAGATGGAAGCTTGATCCTGGTGTCAGCTTCAAGAGACAA
AACTCTCAGAGTATGGGACCTGAAAGATGATGGAAACATGATGAAAGTATTGAGGGGGCATCAGAATTGG
GTGTACAGCTGTGCATTCTCTCCTGACTCTTCTATGCTGTGTTCAGTCGGAGCCAGTAAAGCAGTTTTCC
TTTGGAATATGGATAAATACACCATGATACGGAAACTAGAAGGACATCACCATGATGTGGTAGCTTGTGA
CTTTTCTCCTGATGGAGCATTACTGGCTACTGCATCTTATGATACTCGAGTATATATCTGGGATCCACAT
AATGGAGACATTCTGATGGAATTTGGGCACCTGTTTCCCCCACCTACTCCAATATTTGCTGGAGGAGCAA
ATGACCGGTGGGTACGATCTGTATCTTTTAGCCATGATGGACTGCATGTTGCAAGCCTTGCTGATGATAA
AATGGTGAGGTTCTGGAGAATTGATGAGGATTATCCAGTGCAAGTTGCACCTTTGAGCAATGGTCTTTGC
TGTGCCTTCTCTACTGATGGCAGTGTTTTAGCTGCTGGGACACATGACGGAAGTGTGTATTTTTGGGCCA
CTCCACGGCAGGTCCCTAGCCTGCAACATTTATGTCGCATGTCAATCCGAAGAGTGATGCCCACCCAAGA
AGTTCAGGAGCTGCCGATTCCTTCCAAGCTTTTGGAGTTTCTCTCGTATCGTATTTAG


Restriction Sites SgfI-MluI     
ACCN NM_134265
ORF Size 828 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_134265.2, NP_599027.1
RefSeq Size 2411
RefSeq ORF 828
Locus ID 26118
Domains SOCS, WD40
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the WD-protein subfamily. This protein shares a high sequence identity to mouse and chick proteins. It contains several WD-repeats spanning most of the protein and an SOCS box in the C-terminus. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks two in-frame exons in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.