Aprataxin (APTX) (NM_175069) Human Untagged Clone

CAT#: SC312880

APTX (untagged)-Human aprataxin (APTX), transcript variant 2


  "NM_175069" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "APTX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol APTX
Synonyms AOA; AOA1; AXA1; EAOH; EOAHA; FHA-HIT
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_175069, the custom clone sequence may differ by one or more nucleotides


ATGAGTAACGTGAATTTGTCCGTCTCCGACTTCTGGAGAGTGATGATGCGGGTGTGCTGGTTGGTGAGAC
AGGACAGCCGGCACCAGCGAATCAGACTTCCACATTTGGAAGCAGTTGTGATTGGGCGTGGCCCAGAGAC
CAAGATCACTGATAAGAAATGTTCTCGACAGCAAGTACAGTTGAAAGCAGAGTGTAACAAGGGATATGTC
AAGGTAAAGCAGGTAGGAGTCAATCCCACCAGCATTGACTCAGTCGTAATTGGGAAGGACCAAGAGGTGA
AGCTGCAGCCTGGCCAGGTTCTCCACATGGTGAATGAACTTTATCCATATATTGTAGAGTTTGAGGAAGA
GGCAAAGAACCCTGGCCTGGAAACACACAGGAAGAGAAAGAGATCAGGCAACAGTGATTCTATAGAAAGG
GATGCTGCTCAGGAAGCTGAGGCTGGGACAGGGCTGGAACCTGGGAGCAACTCTGGCCAATGCTCTGTGC
CCCTAAAGAAGGGAAAAGATGCACCTATCAAAAAGGAATCCCTGGGCCACTGGAGTCAAGGCTTGAAGAT
TTCTATGCAGGACCCCAAAATGCAGGTTTACAAAGATGAGCAGGTGGTGGTGATAAAGGATAAATACCCA
AAGGCCCGTTACCATTGGCTGGTCTTACCGTGGACCTCCATTTCCAGTCTGAAGGCTGTGGCCAGGGAAC
ACCTTGAACTCCTTAAGCATATGCACACTGTGGGGGAAAAGGTGATTGTAGATTTTGCTGGGTCCAGCAA
ACTCCGCTTCCGATTGGGCTACCACGCCATTCCGAGTATGAGCCATGTACATCTTCATGTGATCAGCCAG
GATTTTGATTCTCCTTGCCTTAAAAACAAAAAACATTGGAATTCTTTCAATACAGAATACTTCCTAGAAT
CACAAGAGTAG


Restriction Sites Please inquire     
ACCN NM_175069
ORF Size 921 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_175069.1, NP_778239.1
RefSeq Size 2036
RefSeq ORF 921
Locus ID 54840
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (2) has multiple differences compared to variant 1. This variant encodes isoform (g) which has a shorter C-terminus compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.