PGAP2 (NM_014489) Human Untagged Clone
CAT#: SC312925
PGAP2 (untagged)-Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 1
"NM_014489" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PGAP2 |
Synonyms | CWH43-N; FRAG1; HPMRS3; MRT17; MRT21 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_014489, the custom clone sequence may differ by one or more nucleotides
ATGTACCAGGTCCCACTACCACTGGATCGGGATGGGACCCTGGTACGGCTCCGCTTCACCATGGTGGCCC TGGTCACGGTCTGCTGTCCACTTGTCGCCTTCCTCTTCTGCATCCTCTGGTCCCTGCTCTTCCACTTCAA GGAGACAACGGCCACACACTGTGGGGCCACGCCCTGCAGGATGTTCTCTGCGGCCTCCCAGCCTTTGGAC CCCGATGGGACCTTGTTCCGGCTTCGCTTCACAGCCATGGTCTGGTGGGCCATCACTTTTCCTGTGTTCG GCTTCTTCTTCTGCATCATCTGGTCCCTGGTGTTCCACTTTGAGTACACGGTGGCCACTGACTGTGGGGT GCCCAATTACCTGCCCTCGGTGAGCTCAGCCATCGGCGGGGAGGTGCCCCAGCGCTACGTGTGGCGTTTC TGCATCGGCCTGCACTCGGCGCCTCGCTTCTTGGTGGCCTTCGCCTACTGGAACCACTACCTCAGCTGCA CCTCCCCGTGTTCCTGCTATCGCCCGCTCTGCCGCCTCAACTTCGGCCTCAATGTCGTGGAGAACCTCGC GTTGCTAGTGCTCACTTATGTCTCCTCCTCCGAGGACTTCACCATCCACGAAAATGCTTTCATTGTGTTC ATTGCCTCATCCCTCGGGCACATGCTCCTCACCTGCATTCTCTGGCGGTTGACCAAGAAGCACACAGTAA GTCAGGAGGATCGCAAGTCCTACAGCTGGAAACAGCGGCTCTTCATCATCAACTTCATCTCCTTCTTCTC GGCGCTGGCTGTCTACTTTCGGCACAACATGTATTGTGAGGCTGGAGTGTACACCATCTTTGCCATCCTG GAGTACACTGTTGTCTTAACCAACATGGCGTTCCACATGACGGCCTGGTGGGACTTCGGGAACAAGGAGC TGCTCATAACCTCTCAGCCTGAGGAAAAGCGATTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_014489 |
ORF Size | 948 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_014489.3, NP_055304.1 |
RefSeq Size | 2001 |
RefSeq ORF | 948 |
Locus ID | 27315 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213084 | PGAP2 (Myc-DDK-tagged)-Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 1 |
USD 420.00 |
|
RG213084 | PGAP2 (GFP-tagged) - Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 1 |
USD 460.00 |
|
RC213084L1 | Lenti ORF clone of Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC213084L2 | Lenti ORF clone of Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC213084L3 | Lenti ORF clone of Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC213084L4 | Lenti ORF clone of Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review