GM CSF Receptor alpha (CSF2RA) (NM_172247) Human Untagged Clone

CAT#: SC313001

CSF2RA (untagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSF2RA
• Synonyms: alphaGMR; CD116; CDw116; CSF2R; CSF2RAX; CSF2RAY; CSF2RX; CSF2RY; GM-CSF-R-alpha; GMCSFR; GMR; SMDP4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_172247, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTTCTCCTGGTGACAAGCCTTCTGCTCTGTGAGTTACCACACCCAGCATTCCTCCTGATCCCAGAGA
  AATCGGATCTGCGAACAGTGGCACCAGCCTCTAGTCTCAATGTGAGGTTTGACTCCAGGACGATGAATTT
  AAGCTGGGACTGCCAAGAAAACACAACCTTCAGCAAGTGTTTCTTAACTGACAAGAAGAACAGAGTCGTG
  GAACCCAGGCTCAGTAACAACGAATGTTCGTGCACATTTCGTGAAATTTGTCTGCATGAAGGAGTCACAT
  TTGAGGTTCACGTGAATACTAGTCAAAGAGGATTTCAACAGAAACTGCTTTATCCAAATTCAGGAAGGGA
  GGGTACCGCTGCTCAGAATTTCTCCTGTTTCATCTACAATGCGGATTTAATGAACTGTACCTGGGCGAGG
  GGTCCGACGGCCCCCCGTGACGTCCAGTATTTTTTGTACATACGAAACTCAAAGAGAAGGAGGGAGATCC
  GGTGTCCTTATTACATACAAGACTCAGGAACCCATGTGGGATGTCACCTGGATAACCTGTCAGGATTAAC
  GTCTCGCAATTACTTTCTGGTTAACGGAACCAGCCGAGAAATTGGCATCCAATTCTTTGATTCACTTTTG
  GACACAAAGAAAATAGAACGATTCAACCCTCCCAGCAATGTCACCGTACGTTGCAACACGACGCACTGCC
  TCGTACGGTGGAAACAGCCCAGGACCTATCAGAAGCTGTCGTACCTGGACTTTCAGTACCAGCTGGACGT
  CCACAGAAAGAATACCCAGCCTGGCACGGAAAACCTACTGATTAATGTTTCTGGTGATTTGGAAAATAGA
  TACAACTTTCCAAGCTCTGAGCCCAGAGCAAAACACAGTGTGAAGATCAGAGCTGCAGACGTCCGCATCT
  TGAATTGGAGCTCCTGGAGTGAAGCCATTGAATTTGGTTCCTTAGGATACAGCGGCTGTTCCCGCCAGTT
  CCACAGATCAAAGACAAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_172247
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_172247.2, NP_758450.1
• RefSeq Size: 1590 bp
• RefSeq ORF: 1002 bp
• Locus ID: 1438
• Cytogenetics: X;Y
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway, Pathways in cancer
• Gene Summary: 'The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (4) lacks a coding exon in the 3' region, which causes a frameshift, compared to variant 1. The resulting isoform (c), which is likely soluble, is shorter and has a distinct C-terminus compared to isoform a.