GCNT2 (NM_145655) Human Untagged Clone

CAT#: SC313314

GCNT2 (untagged)-Human glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) (GCNT2), transcript variant 3


  "NM_145655" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GCNT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GCNT2
Synonyms bA360O19.2; bA421M1.1; CCAT; CTRCT13; GCNT2C; GCNT5; IGNT; II; NACGT1; NAGCT1; ULG3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145655, the custom clone sequence may differ by one or more nucleotides


ATGAACTTTTGGAGGTACTGCTTTTTTGCTTTCACTCTGCTCAGCGTGGTCATTTTTGTGAGATTTTACA
GTAGCCAATTGAGCCCGCCAAAAAGTTATGAGAAGCTGAACAGTTCCAGTGAAAGGTATTTTAGGAAAAC
TGCCTGTAATCACGCCTTAGAGAAAATGCCAGTCTTTTTGTGGGAAAATATATTACCATCACCTTTGCGA
AGTGTCCCTTGCAAGGATTACCTGACCCAGAATCACTACATCACAAGTCCCCTGTCGGAAGAAGAGGCTG
CATTCCCTTTGGCCTATGTCATGGTCATCCATAAGGACTTTGACACCTTTGAAAGGCTCTTTAGGGCTAT
CTATATGCCCCAAAATGTCTACTGTGTTCACGTGGATGAGAAAGCCCCAGCTGAGTATAAGGAATCTGTG
AGGCAGTTACTGAGTTGCTTCCAAAATGCTTTCATTGCTTCAAAGACAGAGTCTGTGGTTTATGCAGGCA
TTTCCAGACTCCAGGCTGACCTGAACTGTCTGAAAGACCTTGTCGCCTCTGAGGTTCCCTGGAAGTACGT
CATCAACACCTGTGGACAAGACTTCCCCCTGAAAACCAACCGGGAGATAGTTCAGCATCTGAAAGGATTT
AAAGGGAAAAATATCACCCCAGGGGTGCTGCCTCCTGACCATGCAATTAAGCGAACTAAATATGTCCACC
AAGAGCATACAGATAAAGGTGGCTTTTTTGTGAAAAATACTAATATTTTGAAAACTTCACCTCCACATCA
GCTGACCATCTACTTTGGCACTGCCTATGTGGCGCTTACCAGAGACTTTGTCGACTTTGTTCTACGTGAC
CAAAGGGCCATTGATCTACTACAATGGTCAAAAGATACCTATAGTCCTGATGAGCATTTCTGGGTGACAC
TTAATAGGGTTTCAGGTGTTCCTGGCTCTATGCCAAATGCATCCTGGACTGGAAACCTCAGAGCTATAAA
GTGGAGTGACATGGAAGACAGACACGGAGGCTGCCACGGCCACTATGTACATGGTATTTGTATCTATGGA
AACGGAGACTTAAAGTGGCTGGTTAATTCACCAAGCCTGTTTGCTAACAAGTTTGAGCTTAATACCTACC
CCCTTACTGTGGAATGCCTAGAACTGAGGCATCGCGAAAGAACCCTCAATCAGAGTGAAACTGCGATACA
ACCCAGCTGGTATTTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_145655
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145655.3, NP_663630.2
RefSeq Size 4219 bp
RefSeq ORF 1209 bp
Locus ID 2651
Cytogenetics 6p24.3-p24.2
Domains Branch
Protein Families Druggable Genome, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Gene Summary 'This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) contains a different 5' end exon compared to variant 2. The encoded isoform (C) is longer and has a distinct N-terminus, compared to isoform B. Sequence Note: This RefSeq record represents the GCNT2*001.1.1 allele.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.