SHARPIN (NM_030974) Human Untagged Clone
CAT#: SC313342
SHARPIN (untagged)-Human SHANK-associated RH domain interactor (SHARPIN), transcript variant 1
"NM_030974" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SHARPIN |
Synonyms | SIPL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_030974, the custom clone sequence may differ by one or more nucleotides
ATGGCGCCGCCAGCGGGCGGGGCGGCGGCGGCGGCCTCGGACTTGGGCTCCGCCGCAGTGCTCTTGGCTG TGCACGCCGCGGTGAGGCCGCTGGGCGCCGGGCCAGACGCCGAGGCACAGCTGCGGAGGCTGCAGCTGAG CGCGGACCCTGAGCGGCCTGGGCGCTTCCGGCTGGAGCTGCTGGGCGCGGGACCTGGGGCGGTTAATTTG GAGTGGCCCCTGGAGTCAGTTTCCTACACCATCCGAGGCCCCACCCAGCACGAGCTACAGCCTCCACCAG GAGGGCCTGGAACCCTCAGCCTGCACTTCCTCAACCCTCAGGAAGCTCAGCGGTGGGCAGTCCTAGTCCG AGGTGCCACCGTGGAAGGACAGAATGGCAGCAAGAGCAACTCACCACCAGCCTTGGGCCCAGAAGCATGC CCTGTCTCCCTGCCCAGTCCCCCGGAAGCCTCCACACTCAAGGGCCCTCCACCTGAGGCAGATCTTCCTA GGAGCCCTGGAAACTTGACGGAGAGAGAAGAGCTGGCAGGGAGCCTGGCCCGGGCTATTGCAGGTGGAGA CGAGAAGGGGGCAGCCCAAGTGGCAGCCGTCCTGGCCCAGCATCGTGTGGCCCTGAGTGTTCAGCTTCAG GAGGCCTGCTTCCCACCTGGCCCCATCAGGCTGCAGGTCACACTTGAAGACGCTGCCTCTGCCGCATCCG CCGCGTCCTCTGCACACGTTGCCCTGCAGGTCCACCCCCACTGCACTGTTGCAGCTCTCCAGGAGCAGGT GTTCTCAGAGCTCGGTTTCCCGCCAGCCGTGCAACGCTGGGTCATCGGACGGTGCCTGTGTGTGCCTGAG CGCAGCCTTGCCTCTTACGGGGTTCGGCAGGATGGGGACCCTGCTTTCCTCTACTTGCTGTCAGCTCCTC GAGAAGCCCCAGCCACAGGACCTAGCCCTCAGCACCCCCAGAAGATGGACGGGGAACTTGGACGCTTGTT TCCCCCATCATTGGGGCTACCCCCAGGCCCCCAGCCAGCTGCCTCCAGCCTGCCCAGTCCACTCCAGCCC AGCTGGTCCTGTCCTTCCTGCACCTTCATCAATGCCCCAGACCGCCCTGGCTGTGAGATGTGTAGCACCC AGAGGCCCTGCACTTGGGACCCCCTTGCTGCAGCTTCCACCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_030974 |
ORF Size | 1164 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_030974.3, NP_112236.3 |
RefSeq Size | 1816 |
RefSeq ORF | 1164 |
Locus ID | 81858 |
Domains | zf-RanBP |
Protein Families | Druggable Genome |
Gene Summary | Component of the LUBAC complex which conjugates linear polyubiquitin chains in a head-to-tail manner to substrates and plays a key role in NF-kappa-B activation and regulation of inflammation. LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical NF-kappa-B and the JNK signaling pathways. Linear ubiquitination mediated by the LUBAC complex interferes with TNF-induced cell death and thereby prevents inflammation. LUBAC is proposed to be recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of TNF-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex. Together with FAM105B/otulin, the LUBAC complex regulates the canonical Wnt signaling during angiogenesis. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) includes all coding exons, is not a candidate for nonsense-mediated decay, and encodes the protein product. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222012 | SHARPIN (Myc-DDK-tagged)-Human SHANK-associated RH domain interactor (SHARPIN), transcript variant 1 |
USD 420.00 |
|
RG222012 | SHARPIN (GFP-tagged) - Human SHANK-associated RH domain interactor (SHARPIN), transcript variant 1 |
USD 460.00 |
|
RC222012L1 | Lenti ORF clone of Human SHANK-associated RH domain interactor (SHARPIN), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC222012L2 | Lenti ORF clone of Human SHANK-associated RH domain interactor (SHARPIN), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC222012L3 | Lenti ORF clone of Human SHANK-associated RH domain interactor (SHARPIN), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC222012L4 | Lenti ORF clone of Human SHANK-associated RH domain interactor (SHARPIN), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review