Oct-2 (POU2F2) (NM_002698) Human Untagged Clone

CAT#: SC313594

POU2F2 (untagged)-Human POU class 2 homeobox 2 (POU2F2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: POU2F2
• Synonyms: Oct-2; OCT2; OTF2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_002698 edited
  ATGGTTCACTCCAGCATGGGGGCTCCAGAAATAAGAATGTCTAAGCCCCTGGAGGCCGAG
  AAGCAAGGTCTGGACTCCCCATCAGAGCACACAGACACCGAAAGAAATGGACCAGACACT
  AATCATCAGAACCCCCAAAATAAGACCTCCCCATTCTCCGTGTCCCCAACTGGCCCCAGT
  ACAAAGATCAAGGCTGAAGACCCCAGTGGCGATTCAGCCCCAGCAGCACCCCTGCCCCCT
  CAGCCGGCCCAGCCTCATCTGCCCCAGGCCCAACTCATGTTGACGGGCAGCCAGCTAGCT
  GGGGACATACAGCAGCTCCTCCAGCTCCAGCAGCTGGTGCTTGTGCCAGGCCACCACCTC
  CAGCCACCTGCTCAGTTCCTGCTACCGCAGGCCCAGCAGAGCCAGCCAGGCCTGCTACCG
  ACACCAAATCTATTCCAGCTACCTCAGCAAACCCAGGGAGCTCTTCTGACCTCCCAGCCC
  CGGGCCGGGCTTCCCACACAGCCCCCCAAATGCTTGGAGCCACCATCCCACCCCGAGGAG
  CCCAGTGATCTGGAGGAGCTGGAGCAATTCGCCCGCACCTTCAAGCAACGCCGCATCAAG
  CTGGGCTTCACGCAGGGTGATGTGGGCCTGGCCATGGGCAAGCTCTACGGCAACGACTTC
  AGCCAGACGACCATTTCCCGCTTCGAGGCCCTCAACCTGAGCTTCAAGAACATGTGCAAA
  CTCAAGCCCCTCCTGGAGAAGTGGCTCAACGATGCAGAGACTATGTCTGTGGACTCAAGC
  CTGCCCAGCCCCAACCAGCTGAGCAGCCCCAGCCTGGGTTTCGACGGCCTGCCCGGCCGG
  AGACGCAAGAAGAGGACCAGCATCGAGACAAACGTCCGCTTCGCCTTAGAGAAGAGTTTT
  CTAGCGAACCAGAAGCCTACCTCAGAGGAGATCCTGCTGATCGCCGAGCAGCTGCACATG
  GAGAAGGAAGTGATCCGCGTCTGGTTCTGCAACCGGCGCCAGAAGGAGAAACGCATCAAC
  CCCTGCAGTGCGGCCCCCATGCTGCCCAGCCCAGGGAAGCCGGCCAGCTACAGCCCCCAT
  ATGGTCACACCCCAAGGGGGCGCGGGGACCTTACCGTTGTCCCAAGCTTCCAGCAGTCTG
  AGCACAACAGTTACTACCTTATCCTCAGCTGTGGGGACGCTCCACCCCAGCCGGACAGCT
  GGAGGGGGTGGGGGCGGGGGCGGGGCTGCGCCCCCCCTCAATTCCATCCCCTCTGTCACT
  CCCCCACCCCCGGCCACCACCAACAGCACAAACCCCAGCCCTCAAGGCAGCCACTCGGCT
  ATCGGCTTGTCAGGCCTGAACCCCAGCACGGGCCCTGGCCTCTGGTGGAACCCTGCCCCT
  TACCAGCCTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_002698
• Insert Size: 2100 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002698.1, NP_002689.1
• RefSeq Size: 2048 bp
• RefSeq ORF: 1392 bp
• Locus ID: 5452
• Cytogenetics: 19q13.2
• Domains: POU, homeobox
• Protein Families: Transcription Factors
• Gene Summary: 'The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.