Oct-2 (POU2F2) (NM_002698) Human Untagged Clone

CAT#: SC313594

POU2F2 (untagged)-Human POU class 2 homeobox 2 (POU2F2), transcript variant 2


  "NM_002698" in other vectors (6)

Reconstitution Protocol

USD 780.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "POU2F2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol POU2F2
Synonyms Oct-2; OCT2; OTF2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_002698 edited
ATGGTTCACTCCAGCATGGGGGCTCCAGAAATAAGAATGTCTAAGCCCCTGGAGGCCGAG
AAGCAAGGTCTGGACTCCCCATCAGAGCACACAGACACCGAAAGAAATGGACCAGACACT
AATCATCAGAACCCCCAAAATAAGACCTCCCCATTCTCCGTGTCCCCAACTGGCCCCAGT
ACAAAGATCAAGGCTGAAGACCCCAGTGGCGATTCAGCCCCAGCAGCACCCCTGCCCCCT
CAGCCGGCCCAGCCTCATCTGCCCCAGGCCCAACTCATGTTGACGGGCAGCCAGCTAGCT
GGGGACATACAGCAGCTCCTCCAGCTCCAGCAGCTGGTGCTTGTGCCAGGCCACCACCTC
CAGCCACCTGCTCAGTTCCTGCTACCGCAGGCCCAGCAGAGCCAGCCAGGCCTGCTACCG
ACACCAAATCTATTCCAGCTACCTCAGCAAACCCAGGGAGCTCTTCTGACCTCCCAGCCC
CGGGCCGGGCTTCCCACACAGCCCCCCAAATGCTTGGAGCCACCATCCCACCCCGAGGAG
CCCAGTGATCTGGAGGAGCTGGAGCAATTCGCCCGCACCTTCAAGCAACGCCGCATCAAG
CTGGGCTTCACGCAGGGTGATGTGGGCCTGGCCATGGGCAAGCTCTACGGCAACGACTTC
AGCCAGACGACCATTTCCCGCTTCGAGGCCCTCAACCTGAGCTTCAAGAACATGTGCAAA
CTCAAGCCCCTCCTGGAGAAGTGGCTCAACGATGCAGAGACTATGTCTGTGGACTCAAGC
CTGCCCAGCCCCAACCAGCTGAGCAGCCCCAGCCTGGGTTTCGACGGCCTGCCCGGCCGG
AGACGCAAGAAGAGGACCAGCATCGAGACAAACGTCCGCTTCGCCTTAGAGAAGAGTTTT
CTAGCGAACCAGAAGCCTACCTCAGAGGAGATCCTGCTGATCGCCGAGCAGCTGCACATG
GAGAAGGAAGTGATCCGCGTCTGGTTCTGCAACCGGCGCCAGAAGGAGAAACGCATCAAC
CCCTGCAGTGCGGCCCCCATGCTGCCCAGCCCAGGGAAGCCGGCCAGCTACAGCCCCCAT
ATGGTCACACCCCAAGGGGGCGCGGGGACCTTACCGTTGTCCCAAGCTTCCAGCAGTCTG
AGCACAACAGTTACTACCTTATCCTCAGCTGTGGGGACGCTCCACCCCAGCCGGACAGCT
GGAGGGGGTGGGGGCGGGGGCGGGGCTGCGCCCCCCCTCAATTCCATCCCCTCTGTCACT
CCCCCACCCCCGGCCACCACCAACAGCACAAACCCCAGCCCTCAAGGCAGCCACTCGGCT
ATCGGCTTGTCAGGCCTGAACCCCAGCACGGGCCCTGGCCTCTGGTGGAACCCTGCCCCT
TACCAGCCTTGA
Restriction Sites Please inquire     
ACCN NM_002698
Insert Size 2100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002698.1, NP_002689.1
RefSeq Size 2048 bp
RefSeq ORF 1392 bp
Locus ID 5452
Cytogenetics 19q13.2
Domains POU, homeobox
Protein Families Transcription Factors
Gene Summary 'The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.