LBP (NM_004139) Human Untagged Clone

CAT#: SC313662

LBP (untagged)-Human lipopolysaccharide binding protein (LBP)


  "NM_004139" in other vectors (6)

Reconstitution Protocol

USD 810.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LBP
Synonyms BPIFD2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_004139, the custom clone sequence may differ by one or more nucleotides


ATGGGGGCCTTGGCCAGAGCCCTGCCGTCCATACTGCTGGCATTGCTGCTTACGTCCACCCCAGAGGCTC
TGGGTGCCAACCCCGGCTTGGTCGCCAGGATCACCGACAAGGGACTGCAGTATGCGGCCCAGGAGGGGCT
ATTAGCTCTGCAGAGTGAGCTGCTCAGGATCACGCTGCCTGACTTCACCGGGGACTTGAGGATCCCCCAC
GTCGGCCGTGGGCGCTATGAGTTCCACAGCCTGAACATCCACAGCTGTGAGCTGCTTCACTCTGCGCTGA
GGCCTGTCCCTGGCCAGGGCCTGAGTCTCAGCATCTCCGACTCCTCCATCCGGGTCCAGGGCAGGTGGAA
GGTGCGCAAGTCATTCTTCAAACTACAGGGCTCCTTTGATGTCAGTGTCAAGGGCATCAGCATTTCGGTC
AACCTCCTGTTGGGCAGCGAGTCCTCCGGGAGGCCCACAGTTACTGCCTCCAGCTGCAGCAGTGACATCG
CTGACGTGGAGGTGGACATGTCGGGAGACTTGGGGTGGCTGTTGAACCTCTTCCACAACCAGATTGAGTC
CAAGTTCCAGAAAGTACTGGAGAGCAGGATTTGCGAAATGATCCAGAAATCAGTGTCCTCCGATCTACAG
CCTTATCTCCAAACTCTGCCAGTTACAACAGAGATTGACAGTTTCGCCGACATTGATTATAGCTTAGTGG
AAGCCCCTCGGGCAACAGCCCAGATGCTGGAGGTGATGTTTAAGGGTGAAATCTTTCATCGTAACCACCG
TTCTCCAGTTACCCTCCTTGCTGCAGTCATGAGCCTTCCTGAGGAACACAACAAAATGGTCTACTTTGCC
ATCTCGGATTATGTCTTCAACACGGCCAGCCTGGTTTATCATGAGGAAGGATATCTGAACTTCTCCATCA
CAGATGACATGATACCGCCTGACTCTAATATCCGACTGACCACCAAGTCCTTCCGACCCTTCGTCCCACG
GTTAGCCAGGCTCTACCCCAACATGAACCTGGAACTCCAGGGATCAGTGCCCTCTGCTCCGCTCCTGAAC
TTCAGCCCTGGGAATCTGTCTGTGGACCCCTATATGGAGATAGATGCCTTTGTGCTCCTGCCCAGCTCCA
GCAAGGAGCCTGTCTTCCGGCTCAGTGTGGCCACTAATGTGTCCGCCACCTTGACCTTCAATACCAGCAA
GATCACTGGGTTCCTGAAGCCAGGAAAGGTAAAAGTGGAACTGAAAGAATCCAAAGTTGGACTATTCAAT
GCAGAGCTGTTGGAAGCGCTCCTCAACTATTACATCCTTAACACCTTCTACCCCAAGTTCAATGATAAGT
TGGCCGAAGGCTTCCCCCTTCCTCTGCTGAAGCGTGTTCAGCTCTACGACCTTGGGCTGCAGATCCATAA
GGACTTCCTGTTCTTGGGTGCCAATGTCCAATACATGAGAGTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_004139
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004139.4, NP_004130.2
RefSeq Size 1894 bp
RefSeq ORF 1446 bp
Locus ID 3929
Cytogenetics 20q11.23
Domains BPI1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Toll-like receptor signaling pathway
Gene Summary 'The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.