LBP (NM_004139) Human Untagged Clone
CAT#: SC313662
LBP (untagged)-Human lipopolysaccharide binding protein (LBP)
"NM_004139" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LBP |
Synonyms | BPIFD2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_004139, the custom clone sequence may differ by one or more nucleotides
ATGGGGGCCTTGGCCAGAGCCCTGCCGTCCATACTGCTGGCATTGCTGCTTACGTCCACCCCAGAGGCTC TGGGTGCCAACCCCGGCTTGGTCGCCAGGATCACCGACAAGGGACTGCAGTATGCGGCCCAGGAGGGGCT ATTAGCTCTGCAGAGTGAGCTGCTCAGGATCACGCTGCCTGACTTCACCGGGGACTTGAGGATCCCCCAC GTCGGCCGTGGGCGCTATGAGTTCCACAGCCTGAACATCCACAGCTGTGAGCTGCTTCACTCTGCGCTGA GGCCTGTCCCTGGCCAGGGCCTGAGTCTCAGCATCTCCGACTCCTCCATCCGGGTCCAGGGCAGGTGGAA GGTGCGCAAGTCATTCTTCAAACTACAGGGCTCCTTTGATGTCAGTGTCAAGGGCATCAGCATTTCGGTC AACCTCCTGTTGGGCAGCGAGTCCTCCGGGAGGCCCACAGTTACTGCCTCCAGCTGCAGCAGTGACATCG CTGACGTGGAGGTGGACATGTCGGGAGACTTGGGGTGGCTGTTGAACCTCTTCCACAACCAGATTGAGTC CAAGTTCCAGAAAGTACTGGAGAGCAGGATTTGCGAAATGATCCAGAAATCAGTGTCCTCCGATCTACAG CCTTATCTCCAAACTCTGCCAGTTACAACAGAGATTGACAGTTTCGCCGACATTGATTATAGCTTAGTGG AAGCCCCTCGGGCAACAGCCCAGATGCTGGAGGTGATGTTTAAGGGTGAAATCTTTCATCGTAACCACCG TTCTCCAGTTACCCTCCTTGCTGCAGTCATGAGCCTTCCTGAGGAACACAACAAAATGGTCTACTTTGCC ATCTCGGATTATGTCTTCAACACGGCCAGCCTGGTTTATCATGAGGAAGGATATCTGAACTTCTCCATCA CAGATGACATGATACCGCCTGACTCTAATATCCGACTGACCACCAAGTCCTTCCGACCCTTCGTCCCACG GTTAGCCAGGCTCTACCCCAACATGAACCTGGAACTCCAGGGATCAGTGCCCTCTGCTCCGCTCCTGAAC TTCAGCCCTGGGAATCTGTCTGTGGACCCCTATATGGAGATAGATGCCTTTGTGCTCCTGCCCAGCTCCA GCAAGGAGCCTGTCTTCCGGCTCAGTGTGGCCACTAATGTGTCCGCCACCTTGACCTTCAATACCAGCAA GATCACTGGGTTCCTGAAGCCAGGAAAGGTAAAAGTGGAACTGAAAGAATCCAAAGTTGGACTATTCAAT GCAGAGCTGTTGGAAGCGCTCCTCAACTATTACATCCTTAACACCTTCTACCCCAAGTTCAATGATAAGT TGGCCGAAGGCTTCCCCCTTCCTCTGCTGAAGCGTGTTCAGCTCTACGACCTTGGGCTGCAGATCCATAA GGACTTCCTGTTCTTGGGTGCCAATGTCCAATACATGAGAGTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_004139 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004139.4, NP_004130.2 |
RefSeq Size | 1894 bp |
RefSeq ORF | 1446 bp |
Locus ID | 3929 |
Cytogenetics | 20q11.23 |
Domains | BPI1 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Toll-like receptor signaling pathway |
Gene Summary | 'The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221961 | LBP (Myc-DDK-tagged)-Human lipopolysaccharide binding protein (LBP) |
USD 420.00 |
|
RG221961 | LBP (GFP-tagged) - Human lipopolysaccharide binding protein (LBP) |
USD 460.00 |
|
RC221961L1 | Lenti ORF clone of Human lipopolysaccharide binding protein (LBP), Myc-DDK-tagged |
USD 768.00 |
|
RC221961L2 | Lenti ORF clone of Human lipopolysaccharide binding protein (LBP), mGFP tagged |
USD 620.00 |
|
RC221961L3 | Lenti ORF clone of Human lipopolysaccharide binding protein (LBP), Myc-DDK-tagged |
USD 620.00 |
|
RC221961L4 | Lenti ORF clone of Human lipopolysaccharide binding protein (LBP), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review