TRAPPC6B (NM_001079537) Human Untagged Clone

CAT#: SC315477

TRAPPC6B (untagged)-Human trafficking protein particle complex 6B (TRAPPC6B), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRAPPC6B
• Synonyms: NEDMEBA; TPC6
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001079537, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGATGAGGCGTTGTTTTTGCTTCTCCATAACGAGATGGTGTCTGGAGTGTACAAG
  TCCGCGGAGCAGGGGGAGGTGGAAAACGGACGATGTATTACTAAGCTGGAAAACATGGGG
  TTTCGAGTGGGACAAGGATTGATAGAAAGGTTTACAAAAGATACTGCAAGGTTCAAGGAT
  GAGTTAGATATCATGAAGTTCATTTGTAAAGATTTTTGGACTACGGTATTCAAGAAACAA
  ATCGACAATCTAAGGACAAATCATCAGGGCATCTATGTACTTCAGGACAACAAATTTCGC
  CTGCTTACTCAGATGTCTGCAGGAAAACAGTATTTAGAACATGCATCTAAGTATTTAGCA
  TTTACGTGTGGCTTAATCAGAGGTGGCTTATCAAACTTGGGAATAAAAAGTATTGTAACA
  GCTGAAGTGTCTTCAATGCCTGCTTGCAAATTTCAGGTGATGATACAGAAGCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001079537
• ORF Size: 477 bp
• Insert Size: 0
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001079537.1, NP_001073005.1
• RefSeq Size: 3364
• RefSeq ORF: 477
• Locus ID: 122553
• Gene Summary: TRAPPC6B is a component of TRAPP complexes, which are tethering complexes involved in vesicle transport (Kummel et al., 2005 [PubMed 16025134]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). CCDS Note: This CCDS ID represents the longer isoform encoded by the TRAPPC6B gene. The shorter isoform is represented by CCDS9670.1.