BEX4 (NM_001080425) Human Untagged Clone
CAT#: SC315668
BEX4 (untagged)-Human brain expressed, X-linked 4 (BEX4), transcript variant 2
"NM_001080425" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BEX4 |
Synonyms | BEXL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001080425, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCCAAAGAGGAACTAGCGGCAAACAATCTCAACGGGGAAAATGCCCAACAAGAAAACGAAGGAG GGGAGCAGGCCCCCACGCAGAATGAAGAAGAATCCCGCCATTTGGGAGGGGGTGAAGGCCAGAAGCCTGG AGGAAATATCAGGCGGGGGCGAGTTAGGCGACTTGTCCCTAATTTTCGATGGGCCATACCTAATAGGCAT ATTGAGCACAATGAAGCGAGAGATGATGTAGAAAGGTTTGTAGGGCAGATGATGGAAATCAAGAGAAAGA CTAGGGAACAGCAGATGAGGCACTATATGCGCTTCCAAACTCCTGAACCTGACAACCATTATGACTTTTG CCTCATACCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001080425 |
ORF Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001080425.3, NP_001073894.1 |
RefSeq Size | 1282 |
RefSeq ORF | 363 |
Locus ID | 56271 |
Gene Summary | This gene is a member of the brain expressed X-linked gene family. The proteins encoded by some of the other members of this family act as transcription elongation factors which allow RNA polymerase II to escape pausing during elongation. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) contains an alternate non-coding exon in the 5' UTR. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213659 | BEX4 (Myc-DDK-tagged)-Human brain expressed, X-linked 4 (BEX4), transcript variant 2 |
USD 98.00 |
|
RG213659 | BEX4 (GFP-tagged) - Human brain expressed, X-linked 4 (BEX4), transcript variant 2 |
USD 460.00 |
|
RC213659L3 | Lenti ORF clone of Human brain expressed, X-linked 4 (BEX4), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC213659L4 | Lenti ORF clone of Human brain expressed, X-linked 4 (BEX4), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review