EMG1 (NM_006331) Human Untagged Clone

CAT#: SC315700

EMG1 (untagged)-Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1)


  "NM_006331" in other vectors (7)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "EMG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EMG1
Synonyms C2F; Grcc2f; NEP1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_006331, the custom clone sequence may differ by one or more nucleotides


ATGGCCGCGCCCAGTGATGGATTCAAGCCTCGTGAACGAAGCGGTGGGGAGCAGGCACAGGACTGGGATG
CTCTGCCACCCAAGCGGCCCCGACTAGGGGCAGGAAACAAGATCGGAGGCCGTAGGCTTATTGTGGTGCT
GGAAGGGGCCAGTCTGGAGACAGTCAAGGTAGGGAAGACATATGAGCTACTCAACTGTGACAAGCACAAG
TCTATATTGTTGAAGAATGGACGGGACCCTGGGGAAGCGCGGCCAGATATCACCCACCAGAGTTTGCTGA
TGCTGATGGATAGTCCCCTGAACCGAGCTGGCTTGCTACAGGTTTATATCCATACACAGAAGAATGTTCT
GATTGAAGTGAATCCCCAGACCCGAATTCCCAGAACCTTTGACCGCTTTTGTGGCCTCATGGTTCAACTT
TTACACAAGCTCAGTGTTCGAGCAGCTGATGGCCCCCAGAAGCTTTTGAAGGTAATTAAGAATCCAGTAT
CAGATCACTTTCCAGTTGGATGTATGAAAGTTGGCACTTCTTTTTCCATCCCGGTTGTCAGTGATGTGCG
TGAGCTGGTGCCCAGCAGTGATCCTATTGTTTTTGTGGTAGGGGCCTTTGCCCATGGCAAGGTCAGTGTG
GAGTATACAGAGAAGATGGTGTCCATCAGTAACTACCCCCTTTCTGCTGCCCTCACCTGTGCAAAACTTA
CCACAGCCTTTGAGGAAGTATGGGGGGTCATTTGA


Restriction Sites Please inquire     
ACCN NM_006331
ORF Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Reference Data
RefSeq NM_006331.4, NP_006322.2
RefSeq Size 1019
RefSeq ORF 735
Locus ID 10436
Domains Mra1
Gene Summary This gene encodes an essential, conserved eukaryotic protein that methylates pseudouridine in 18S rRNA. The related protein in yeast is a component of the small subunit processome and is essential for biogenesis of the ribosomal 40S subunit. A mutation in this gene has been associated with Bowen-Conradi syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.